ID: 943356944

View in Genome Browser
Species Human (GRCh38)
Location 2:186867680-186867702
Sequence CTCTTCTTCTTAAGGTCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943356938_943356944 13 Left 943356938 2:186867644-186867666 CCAAAGGAAGGTAAGCAGTTCAG No data
Right 943356944 2:186867680-186867702 CTCTTCTTCTTAAGGTCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943356944 Original CRISPR CTCTTCTTCTTAAGGTCAAT CGG Intergenic
No off target data available for this crispr