ID: 943357241

View in Genome Browser
Species Human (GRCh38)
Location 2:186871550-186871572
Sequence CACCAAGGCAAACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943357241_943357243 15 Left 943357241 2:186871550-186871572 CCTCTTTGGGGTTTGCCTTGGTG No data
Right 943357243 2:186871588-186871610 TGCTCCAATATTTTCTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943357241 Original CRISPR CACCAAGGCAAACCCCAAAG AGG (reversed) Intergenic
No off target data available for this crispr