ID: 943368376

View in Genome Browser
Species Human (GRCh38)
Location 2:186985712-186985734
Sequence TGCAGGTTGTTGAGGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943368376_943368379 2 Left 943368376 2:186985712-186985734 CCTCATGGCCTCAACAACCTGCA No data
Right 943368379 2:186985737-186985759 AGCAACCATGTTTTCCCACCTGG No data
943368376_943368385 30 Left 943368376 2:186985712-186985734 CCTCATGGCCTCAACAACCTGCA No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943368376 Original CRISPR TGCAGGTTGTTGAGGCCATG AGG (reversed) Intergenic
No off target data available for this crispr