ID: 943368380

View in Genome Browser
Species Human (GRCh38)
Location 2:186985742-186985764
Sequence TAAGACCAGGTGGGAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943368380_943368386 12 Left 943368380 2:186985742-186985764 CCATGTTTTCCCACCTGGTCTTA No data
Right 943368386 2:186985777-186985799 GACCCAAATGGCCTTCACATTGG No data
943368380_943368385 0 Left 943368380 2:186985742-186985764 CCATGTTTTCCCACCTGGTCTTA No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943368380 Original CRISPR TAAGACCAGGTGGGAAAACA TGG (reversed) Intergenic
No off target data available for this crispr