ID: 943368381

View in Genome Browser
Species Human (GRCh38)
Location 2:186985751-186985773
Sequence CATGATCGGTAAGACCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943368381_943368390 30 Left 943368381 2:186985751-186985773 CCCACCTGGTCTTACCGATCATG No data
Right 943368390 2:186985804-186985826 CACAACTGTCCTTAATCTTCTGG No data
943368381_943368385 -9 Left 943368381 2:186985751-186985773 CCCACCTGGTCTTACCGATCATG No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data
943368381_943368386 3 Left 943368381 2:186985751-186985773 CCCACCTGGTCTTACCGATCATG No data
Right 943368386 2:186985777-186985799 GACCCAAATGGCCTTCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943368381 Original CRISPR CATGATCGGTAAGACCAGGT GGG (reversed) Intergenic
No off target data available for this crispr