ID: 943368385

View in Genome Browser
Species Human (GRCh38)
Location 2:186985765-186985787
Sequence CCGATCATGCATGACCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943368378_943368385 13 Left 943368378 2:186985729-186985751 CCTGCATTAGCAACCATGTTTTC No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data
943368377_943368385 22 Left 943368377 2:186985720-186985742 CCTCAACAACCTGCATTAGCAAC No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data
943368376_943368385 30 Left 943368376 2:186985712-186985734 CCTCATGGCCTCAACAACCTGCA No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data
943368381_943368385 -9 Left 943368381 2:186985751-186985773 CCCACCTGGTCTTACCGATCATG No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data
943368380_943368385 0 Left 943368380 2:186985742-186985764 CCATGTTTTCCCACCTGGTCTTA No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data
943368382_943368385 -10 Left 943368382 2:186985752-186985774 CCACCTGGTCTTACCGATCATGC No data
Right 943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943368385 Original CRISPR CCGATCATGCATGACCCAAA TGG Intergenic
No off target data available for this crispr