ID: 943371558

View in Genome Browser
Species Human (GRCh38)
Location 2:187022950-187022972
Sequence AGGTTCCTGGATGGCACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943371558_943371568 29 Left 943371558 2:187022950-187022972 CCAAGAGTGCCATCCAGGAACCT No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data
943371558_943371564 9 Left 943371558 2:187022950-187022972 CCAAGAGTGCCATCCAGGAACCT No data
Right 943371564 2:187022982-187023004 CTTGTCCCATCTGTCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943371558 Original CRISPR AGGTTCCTGGATGGCACTCT TGG (reversed) Intergenic
No off target data available for this crispr