ID: 943371562

View in Genome Browser
Species Human (GRCh38)
Location 2:187022970-187022992
Sequence GATGGGACAAGGCAATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943371562_943371568 9 Left 943371562 2:187022970-187022992 CCTGGAGATTGCCTTGTCCCATC No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943371562 Original CRISPR GATGGGACAAGGCAATCTCC AGG (reversed) Intergenic
No off target data available for this crispr