ID: 943371566

View in Genome Browser
Species Human (GRCh38)
Location 2:187022988-187023010
Sequence TATGCTCCTGAGGTGACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943371566_943371568 -9 Left 943371566 2:187022988-187023010 CCATCTGTCACCTCAGGAGCATA No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943371566 Original CRISPR TATGCTCCTGAGGTGACAGA TGG (reversed) Intergenic
No off target data available for this crispr