ID: 943371568

View in Genome Browser
Species Human (GRCh38)
Location 2:187023002-187023024
Sequence AGGAGCATACATACACCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943371565_943371568 -8 Left 943371565 2:187022987-187023009 CCCATCTGTCACCTCAGGAGCAT No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data
943371560_943371568 20 Left 943371560 2:187022959-187022981 CCATCCAGGAACCTGGAGATTGC No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data
943371562_943371568 9 Left 943371562 2:187022970-187022992 CCTGGAGATTGCCTTGTCCCATC No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data
943371558_943371568 29 Left 943371558 2:187022950-187022972 CCAAGAGTGCCATCCAGGAACCT No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data
943371561_943371568 16 Left 943371561 2:187022963-187022985 CCAGGAACCTGGAGATTGCCTTG No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data
943371566_943371568 -9 Left 943371566 2:187022988-187023010 CCATCTGTCACCTCAGGAGCATA No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data
943371563_943371568 -2 Left 943371563 2:187022981-187023003 CCTTGTCCCATCTGTCACCTCAG No data
Right 943371568 2:187023002-187023024 AGGAGCATACATACACCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943371568 Original CRISPR AGGAGCATACATACACCATT AGG Intergenic
No off target data available for this crispr