ID: 943372763

View in Genome Browser
Species Human (GRCh38)
Location 2:187036275-187036297
Sequence ATGCCCATCCAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943372761_943372763 21 Left 943372761 2:187036231-187036253 CCTCATTTACTCCAAACTGTAAA No data
Right 943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG No data
943372762_943372763 10 Left 943372762 2:187036242-187036264 CCAAACTGTAAAAAAAAAGAGAC No data
Right 943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943372763 Original CRISPR ATGCCCATCCAGAAGAGTGA AGG Intergenic
No off target data available for this crispr