ID: 943384063

View in Genome Browser
Species Human (GRCh38)
Location 2:187181081-187181103
Sequence GACAGATCTTTACCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943384063_943384065 11 Left 943384063 2:187181081-187181103 CCAGTAACAGGTAAAGATCTGTC No data
Right 943384065 2:187181115-187181137 GCATAGCTATCTGTGGAAGATGG No data
943384063_943384064 4 Left 943384063 2:187181081-187181103 CCAGTAACAGGTAAAGATCTGTC No data
Right 943384064 2:187181108-187181130 AAAAAGAGCATAGCTATCTGTGG No data
943384063_943384066 15 Left 943384063 2:187181081-187181103 CCAGTAACAGGTAAAGATCTGTC No data
Right 943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG No data
943384063_943384067 16 Left 943384063 2:187181081-187181103 CCAGTAACAGGTAAAGATCTGTC No data
Right 943384067 2:187181120-187181142 GCTATCTGTGGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943384063 Original CRISPR GACAGATCTTTACCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr