ID: 943384064

View in Genome Browser
Species Human (GRCh38)
Location 2:187181108-187181130
Sequence AAAAAGAGCATAGCTATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943384062_943384064 5 Left 943384062 2:187181080-187181102 CCCAGTAACAGGTAAAGATCTGT No data
Right 943384064 2:187181108-187181130 AAAAAGAGCATAGCTATCTGTGG No data
943384061_943384064 11 Left 943384061 2:187181074-187181096 CCAAAGCCCAGTAACAGGTAAAG No data
Right 943384064 2:187181108-187181130 AAAAAGAGCATAGCTATCTGTGG No data
943384063_943384064 4 Left 943384063 2:187181081-187181103 CCAGTAACAGGTAAAGATCTGTC No data
Right 943384064 2:187181108-187181130 AAAAAGAGCATAGCTATCTGTGG No data
943384060_943384064 14 Left 943384060 2:187181071-187181093 CCACCAAAGCCCAGTAACAGGTA No data
Right 943384064 2:187181108-187181130 AAAAAGAGCATAGCTATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943384064 Original CRISPR AAAAAGAGCATAGCTATCTG TGG Intergenic
No off target data available for this crispr