ID: 943384066

View in Genome Browser
Species Human (GRCh38)
Location 2:187181119-187181141
Sequence AGCTATCTGTGGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943384060_943384066 25 Left 943384060 2:187181071-187181093 CCACCAAAGCCCAGTAACAGGTA No data
Right 943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG No data
943384063_943384066 15 Left 943384063 2:187181081-187181103 CCAGTAACAGGTAAAGATCTGTC No data
Right 943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG No data
943384061_943384066 22 Left 943384061 2:187181074-187181096 CCAAAGCCCAGTAACAGGTAAAG No data
Right 943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG No data
943384062_943384066 16 Left 943384062 2:187181080-187181102 CCCAGTAACAGGTAAAGATCTGT No data
Right 943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943384066 Original CRISPR AGCTATCTGTGGAAGATGGC AGG Intergenic
No off target data available for this crispr