ID: 943384516

View in Genome Browser
Species Human (GRCh38)
Location 2:187184888-187184910
Sequence CAGGATCAGCTGGCAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943384516_943384526 0 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384526 2:187184911-187184933 GGTTTTTTGGGGGGACAGAATGG No data
943384516_943384527 1 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384527 2:187184912-187184934 GTTTTTTGGGGGGACAGAATGGG No data
943384516_943384524 -9 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384524 2:187184902-187184924 CTGATCCTGGGTTTTTTGGGGGG No data
943384516_943384532 17 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384532 2:187184928-187184950 GAATGGGAGAGGGTTGGGCCAGG No data
943384516_943384533 21 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384533 2:187184932-187184954 GGGAGAGGGTTGGGCCAGGATGG No data
943384516_943384531 12 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384531 2:187184923-187184945 GGACAGAATGGGAGAGGGTTGGG No data
943384516_943384529 7 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384529 2:187184918-187184940 TGGGGGGACAGAATGGGAGAGGG No data
943384516_943384528 6 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384528 2:187184917-187184939 TTGGGGGGACAGAATGGGAGAGG No data
943384516_943384530 11 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384530 2:187184922-187184944 GGGACAGAATGGGAGAGGGTTGG No data
943384516_943384523 -10 Left 943384516 2:187184888-187184910 CCTTTCTCTGCCAGCTGATCCTG No data
Right 943384523 2:187184901-187184923 GCTGATCCTGGGTTTTTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943384516 Original CRISPR CAGGATCAGCTGGCAGAGAA AGG (reversed) Intergenic
No off target data available for this crispr