ID: 943388126

View in Genome Browser
Species Human (GRCh38)
Location 2:187227107-187227129
Sequence AGTTATCTGCAGAAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943388126_943388131 16 Left 943388126 2:187227107-187227129 CCTACCATCTTCTGCAGATAACT No data
Right 943388131 2:187227146-187227168 GCAGCTCTTGGCCTGTTACTGGG No data
943388126_943388132 25 Left 943388126 2:187227107-187227129 CCTACCATCTTCTGCAGATAACT No data
Right 943388132 2:187227155-187227177 GGCCTGTTACTGGGCTTTAGCGG 0: 7
1: 155
2: 166
3: 94
4: 178
943388126_943388130 15 Left 943388126 2:187227107-187227129 CCTACCATCTTCTGCAGATAACT No data
Right 943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG 0: 9
1: 173
2: 187
3: 147
4: 210
943388126_943388129 4 Left 943388126 2:187227107-187227129 CCTACCATCTTCTGCAGATAACT No data
Right 943388129 2:187227134-187227156 TGCTTTTGAGAGGCAGCTCTTGG No data
943388126_943388128 -6 Left 943388126 2:187227107-187227129 CCTACCATCTTCTGCAGATAACT No data
Right 943388128 2:187227124-187227146 ATAACTACTCTGCTTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943388126 Original CRISPR AGTTATCTGCAGAAGATGGT AGG (reversed) Intergenic
No off target data available for this crispr