ID: 943391806

View in Genome Browser
Species Human (GRCh38)
Location 2:187279001-187279023
Sequence CTATGTCAACAGTACTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943391800_943391806 26 Left 943391800 2:187278952-187278974 CCTCCGGGTTAAGTACCTGCTGA No data
Right 943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG No data
943391799_943391806 27 Left 943391799 2:187278951-187278973 CCCTCCGGGTTAAGTACCTGCTG No data
Right 943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG No data
943391804_943391806 11 Left 943391804 2:187278967-187278989 CCTGCTGAGTTGGAGGTGTCAAG No data
Right 943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG No data
943391801_943391806 23 Left 943391801 2:187278955-187278977 CCGGGTTAAGTACCTGCTGAGTT No data
Right 943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG No data
943391798_943391806 28 Left 943391798 2:187278950-187278972 CCCCTCCGGGTTAAGTACCTGCT No data
Right 943391806 2:187279001-187279023 CTATGTCAACAGTACTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943391806 Original CRISPR CTATGTCAACAGTACTGTAA TGG Intergenic
No off target data available for this crispr