ID: 943393956

View in Genome Browser
Species Human (GRCh38)
Location 2:187308660-187308682
Sequence AAGAAACAAAACATAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943393956_943393957 13 Left 943393956 2:187308660-187308682 CCTGTTCTTATGTTTTGTTTCTT No data
Right 943393957 2:187308696-187308718 TCTGTAGCCCAGACCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943393956 Original CRISPR AAGAAACAAAACATAAGAAC AGG (reversed) Intergenic
No off target data available for this crispr