ID: 943399226

View in Genome Browser
Species Human (GRCh38)
Location 2:187384335-187384357
Sequence ATGGACTTTTTGGGAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943399226_943399231 16 Left 943399226 2:187384335-187384357 CCTGTTCTTCCCAAAAAGTCCAT No data
Right 943399231 2:187384374-187384396 ATATGATTTTTATCCCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943399226 Original CRISPR ATGGACTTTTTGGGAAGAAC AGG (reversed) Intronic
No off target data available for this crispr