ID: 943403615

View in Genome Browser
Species Human (GRCh38)
Location 2:187450673-187450695
Sequence CAGAAAAAATAAATGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 891
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 815}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943403611_943403615 13 Left 943403611 2:187450637-187450659 CCTAGTAATCCTCAAGAGCTGCC 0: 1
1: 0
2: 1
3: 9
4: 91
Right 943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG 0: 1
1: 0
2: 4
3: 71
4: 815
943403612_943403615 4 Left 943403612 2:187450646-187450668 CCTCAAGAGCTGCCATTTTATAA 0: 1
1: 1
2: 3
3: 20
4: 229
Right 943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG 0: 1
1: 0
2: 4
3: 71
4: 815
943403613_943403615 -8 Left 943403613 2:187450658-187450680 CCATTTTATAAACTTCAGAAAAA 0: 1
1: 1
2: 8
3: 98
4: 908
Right 943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG 0: 1
1: 0
2: 4
3: 71
4: 815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943403615 Original CRISPR CAGAAAAAATAAATGGTACA AGG Intergenic
900756891 1:4441979-4442001 AAACAAAAATAAATGTTACAAGG - Intergenic
900785600 1:4647898-4647920 AAGAAAAGATAAATGGTCAAGGG - Intergenic
901881539 1:12196931-12196953 AAGAAAAAAAAAATGGAAAAGGG - Intronic
902455895 1:16533993-16534015 CAGAAAAAAAAAAAGAGACAAGG + Intergenic
903095809 1:20972288-20972310 CAGAAGAAAAAAATAGCACAAGG - Intronic
904029225 1:27523610-27523632 AAGAAAAGATAAATGGACCAAGG - Intergenic
904119740 1:28189964-28189986 CAAAAAAAATAAATGTTATTTGG - Intronic
904930953 1:34087121-34087143 CAGGAAATGTAAAGGGTACAGGG - Intronic
905958788 1:42025559-42025581 CAGAAATAACAAAGCGTACAGGG - Intronic
906269619 1:44465430-44465452 AAAAAAAAAAAAATGGCACATGG - Intronic
907515795 1:54992540-54992562 AAAAAAAAAGAAATGGTACCTGG - Intergenic
907821212 1:57971431-57971453 CTGAAAAATTATAAGGTACATGG + Intronic
907835753 1:58106935-58106957 AAGAAAAAATAAAGGAAACAAGG - Intronic
907872385 1:58454847-58454869 CAGAAAAAATAAATATTCAAAGG - Intronic
907964312 1:59314417-59314439 CAGAAAGAATCAATGGCACTGGG - Intronic
907977588 1:59447306-59447328 CAGAAAAAAGAAAAGATATAAGG - Intronic
907979707 1:59469703-59469725 CAGGAAAAATAACGGGTACTAGG - Intronic
908214886 1:61941295-61941317 CATAAAACGTAAATGCTACAAGG - Intronic
908873434 1:68641864-68641886 CAGAAAAAAAAAATCCTAAATGG - Intergenic
908944915 1:69483738-69483760 CAGGAAAAATAAATTATCCAAGG - Intergenic
908956413 1:69634562-69634584 CGGAAAACATAAAAGTTACAAGG - Intronic
909335027 1:74463210-74463232 CAGACTCAATAAATAGTACAGGG - Intronic
909354678 1:74695326-74695348 CAGAAAAAATAATGGGAACTAGG - Intergenic
909385884 1:75056293-75056315 CAGAAAAAATAAGGGGAAGAAGG + Intergenic
909539302 1:76772705-76772727 CAGCAAAAATAAATTTTAAAAGG - Intergenic
909866364 1:80677708-80677730 GAAAAAATATAAATGGTACAAGG - Intergenic
910140681 1:84024264-84024286 AAGAAAAAATAACTTGTCCAAGG + Intergenic
910255503 1:85243366-85243388 CAGAAAAAAAAAACTCTACATGG - Intergenic
910255802 1:85246171-85246193 CAGAAACAAAATGTGGTACATGG + Intergenic
910358238 1:86387146-86387168 CATAAAAAATAAAGGTTATAAGG + Intronic
911096338 1:94058128-94058150 CAGATAAAACAAATGGCAAAGGG + Intronic
911346369 1:96701319-96701341 CAGAAAACATAATGGGCACAGGG - Intergenic
912344825 1:108954587-108954609 CAGAAAAAAGATGTGGTACTTGG + Intronic
912663713 1:111560329-111560351 CAGAAACAATAAATGAGACCAGG - Intronic
912964609 1:114226939-114226961 CAGGAAAAAAAAATGGTGCCTGG + Intergenic
913281918 1:117193781-117193803 CAGCAGCAATAAATGGTACTGGG + Intronic
915189180 1:154134415-154134437 AAAAAAAAAAAAAAGGTACACGG - Intronic
915697225 1:157756010-157756032 AAGAAAAAATAAAAGGTATTGGG + Intronic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916121861 1:161535526-161535548 CAGAAAGACTAAATGGAAAAGGG - Intergenic
916131456 1:161615475-161615497 CAGAAAGACTAAATGGAAAAGGG - Intronic
916888811 1:169096818-169096840 AAAAAAAAATAAATTGTAAAAGG + Intergenic
917041878 1:170814035-170814057 CACAATAAAAAAATGATACAGGG + Intergenic
917298789 1:173550735-173550757 TAAAAAAAAAAAATGATACAGGG - Intronic
918163956 1:181926623-181926645 CAGAAACATTAGATGGGACAAGG - Intergenic
918367247 1:183821424-183821446 AAGAAAAAATACATTTTACATGG - Intronic
918497132 1:185153400-185153422 CAGAAAGAATAAATGGTAAGGGG + Intronic
918537611 1:185591247-185591269 CAGAAATAAGAAATGGGAAAGGG + Intergenic
918816022 1:189184491-189184513 CAGCAAAAGCAAATGGTAAAAGG - Intergenic
918923407 1:190746083-190746105 CAGGAAAAATAATAGGTACTAGG + Intergenic
919496798 1:198282748-198282770 CAGAATAAATAAATTGTACCTGG - Intronic
919590791 1:199499315-199499337 CAGATAAAAGAAATTGTAGATGG + Intergenic
920605727 1:207382654-207382676 GAGAGAGAATAAATGGTAGAAGG + Intergenic
920997151 1:211004222-211004244 CAGACTAAATAAATGCTAAAGGG + Intronic
921017829 1:211208292-211208314 CAAAAAAAAGAAATGCTAGAGGG + Intergenic
921372589 1:214439934-214439956 CAGAAGAAACAAAGGGTAGAGGG - Intronic
921564458 1:216699655-216699677 CTGAAAAAAAAAATGGAACGAGG + Intronic
921640435 1:217546492-217546514 CAGAAACAAGCAATGGTAAAAGG + Intronic
922109638 1:222544263-222544285 CAGAAAGAAAAAATGGTGCTAGG + Intronic
922115858 1:222613779-222613801 GAGGAAAAAAAAATGCTACACGG - Intergenic
922119316 1:222646995-222647017 CACAGAAAATAAATGCTGCAAGG + Intronic
922458807 1:225798964-225798986 GGAAAAAAATAAATGTTACAGGG - Intergenic
923014206 1:230113311-230113333 CAGAGAAAGAAACTGGTACAAGG - Intronic
923119351 1:230976665-230976687 TAGAAAAAATAAGTACTACATGG + Intronic
923630557 1:235647050-235647072 CAGAAAAGCTAAATGGTATCAGG - Intronic
923696682 1:236259242-236259264 CAGAAAAGATAAAAGATTCAAGG + Intronic
923731068 1:236550678-236550700 CAGAAAGAGTAAATGATACACGG - Exonic
923826016 1:237501707-237501729 CAGAAAAAGTAACTGGTACGTGG - Intronic
924211718 1:241775278-241775300 TAGGAAAAATACATGGTATATGG + Intronic
924916649 1:248576532-248576554 CAGAAAAAAAAAAGGGAAAACGG - Intergenic
1062879685 10:967854-967876 CACAAAAAATTAATGGGGCATGG - Intergenic
1063071885 10:2675038-2675060 CAGAAAAATAAAATGTTACTTGG + Intergenic
1063645828 10:7882402-7882424 CAGAGGAAATAATTGTTACAGGG + Intronic
1064917294 10:20474122-20474144 CAGGAAAAATAATTGGTACTAGG + Intergenic
1065091686 10:22241480-22241502 AAGAAAAAATAAAGTGGACATGG + Intergenic
1065519792 10:26560630-26560652 CAGAAGAAATAAATACTCCACGG - Intronic
1065648240 10:27859635-27859657 CAGTAAAATTATATTGTACAAGG + Intronic
1066058238 10:31700794-31700816 TATAAAAAATAAATGGTAGGCGG + Intergenic
1066123694 10:32317766-32317788 CACAAGAAATAAATGATACAAGG + Intronic
1066234487 10:33471914-33471936 CACAAAAAATAAATGCTTGAGGG - Intergenic
1066587095 10:36947516-36947538 CACAGAAAATAAATGGATCAAGG - Intergenic
1066610270 10:37238310-37238332 AAAAATAAATAAATGGTAGAAGG - Intronic
1068163888 10:53303396-53303418 GTGAAAAAATAAATTGTATATGG + Intergenic
1068170364 10:53385339-53385361 TAGAAAAAATAAATGAGAAAGGG - Intergenic
1068542448 10:58310516-58310538 CACAAAGAATAAATGCTTCAGGG + Intergenic
1068661259 10:59625631-59625653 CAGTAAAAATTACTGGGACACGG + Intergenic
1068706567 10:60083005-60083027 CAGAAAAAAAAACTGTTAGAAGG - Intronic
1069284646 10:66697928-66697950 CTAAAAGAATAAATGGTTCAGGG - Intronic
1070996176 10:80785152-80785174 TAGAAAAAATAAAGGGTATTGGG + Intergenic
1071001721 10:80838600-80838622 CACAATAAAAAAATGGTAAAAGG - Intergenic
1071190919 10:83099643-83099665 CAGAAAAAAAAAATTTTTCAGGG + Intergenic
1071200441 10:83216069-83216091 CTGAATGAATAAATAGTACAAGG + Intergenic
1072133654 10:92522059-92522081 CACAAAAAAAAAATGGTGAAGGG + Intronic
1073165273 10:101442734-101442756 TAGAAAGGATAAATGATACAGGG + Intronic
1073193990 10:101673074-101673096 CAGAAAGAATAATTGGTTCTTGG - Intronic
1073550488 10:104395965-104395987 CAGAAAAAGTAAAAGAAACATGG - Intronic
1073551557 10:104406790-104406812 CAGAAAACAAAAATGCTACCTGG - Exonic
1073669135 10:105567875-105567897 GAGAAAAAATAAATGATTCTTGG - Intergenic
1073797733 10:107006377-107006399 GAGAATAAATAGATGGCACAGGG + Intronic
1073858300 10:107704787-107704809 TAGACAAAATAAATGTAACAGGG + Intergenic
1074000941 10:109372127-109372149 CAAAAACAATAAATGGGAAAAGG + Intergenic
1074510794 10:114110197-114110219 CAAAAAAAAAAAAAGGTAAAAGG + Intergenic
1074575815 10:114668153-114668175 CTGAATAAAAAAATTGTACATGG + Intronic
1075853317 10:125606196-125606218 GGGAAAAAATAAATCCTACAAGG - Intronic
1076244246 10:128933706-128933728 CCCAAAAACTAAATTGTACAAGG - Intergenic
1077469402 11:2749965-2749987 AAAAAAAAATAAAAAGTACAGGG + Intronic
1077637257 11:3851765-3851787 AATAACAAATAAATGGTACCTGG - Intergenic
1077767431 11:5175573-5175595 AACAAAAAACAAAAGGTACAGGG - Intronic
1079086334 11:17448091-17448113 AAGAAAAGAAAAATCGTACATGG - Intronic
1079539796 11:21559545-21559567 CATAAAAAATAATTGCTATATGG - Intronic
1080105726 11:28509908-28509930 TAGAAAAAAAAAATGATACCTGG - Intergenic
1080176736 11:29371649-29371671 CAAAAAAAAAAAATGATAAAGGG - Intergenic
1080401790 11:31943042-31943064 CAGAAAATATAAATGGTAGTGGG + Intronic
1080553309 11:33393193-33393215 CAGAAAGAATAAAATGTAAAGGG - Intergenic
1081142218 11:39514977-39514999 CAGAAAAAAAAAATGGGATGGGG + Intergenic
1081473177 11:43396227-43396249 CAGAAAAAAAAAAAGGAAAAAGG - Intronic
1081504003 11:43695956-43695978 CAGGAAAAATAATGGGTACTAGG - Intronic
1081554881 11:44149412-44149434 CAGAAAAAAGAAATAGAACATGG - Intronic
1082727628 11:56755496-56755518 CAGAGAATATAAATAGTAAAGGG - Intergenic
1082745096 11:56952388-56952410 CACAAAATATAAGTGTTACAGGG + Intergenic
1082746676 11:56969984-56970006 CAGATCAAATAAATGCTACAAGG - Intergenic
1082900898 11:58250767-58250789 CAGAAAAAAGAAAAGGATCAGGG + Intergenic
1083928467 11:65824155-65824177 CAAAATAAATAAATAGTTCAGGG - Intronic
1084715999 11:70873732-70873754 AAAAAAAAAAAAATGGTAAATGG - Intronic
1085169667 11:74438686-74438708 GAGAAAAAGTAAATTGTCCAAGG + Intergenic
1085187045 11:74584444-74584466 CAAAAAAAATAAAATGTAAAAGG - Intronic
1085652275 11:78278980-78279002 CAGTAAAAAAAAGTGGTAGAGGG - Intronic
1085821494 11:79798541-79798563 CAGAGAAAATAGAGGGTACTTGG - Intergenic
1085821924 11:79803029-79803051 AAGAAAAAAGAAATGGAAGAAGG + Intergenic
1085864344 11:80271227-80271249 GAACAAAAATAAAGGGTACAGGG + Intergenic
1085871672 11:80357592-80357614 CAAGTAAAATAAATGTTACAAGG + Intergenic
1085958519 11:81431122-81431144 CTGAGAAAATAAATAATACATGG + Intergenic
1086112566 11:83216317-83216339 AAAAAAAAAGAAATGGTAAAGGG - Intronic
1086227977 11:84535551-84535573 CAGAGAAAAAAAAAGGTTCAGGG + Intronic
1086725791 11:90182285-90182307 CTGAAAAAATAAATGTGACATGG - Intronic
1086756123 11:90564480-90564502 TAGAAAAAAAAAAGGATACAAGG + Intergenic
1086842957 11:91711128-91711150 AAGAAAAGATAAATGATCCATGG - Intergenic
1086857427 11:91881858-91881880 CAGAAAAATTACATTGTACCTGG + Intergenic
1086872676 11:92057663-92057685 CAGAAAGAATATCTGGTACAAGG + Intergenic
1086882279 11:92162763-92162785 CATGAAAAATAAATGGAAAAAGG - Intergenic
1086915595 11:92526573-92526595 TAGAAAAAATAACTGTCACAGGG + Intronic
1087416746 11:97866323-97866345 CACAAAAGATAAATGCTAGAGGG - Intergenic
1087567642 11:99882679-99882701 CACAAAAGATAAATGCTAAAGGG - Intronic
1088107185 11:106220560-106220582 GAAAAAAAATAAATGGTTCCTGG + Intergenic
1088380622 11:109188649-109188671 CAGAAAAAAGAAATGGGGAAAGG - Intergenic
1088901821 11:114123973-114123995 CAGAAATAATAAGTGGTTCATGG - Intronic
1089430688 11:118421955-118421977 AAAAAAAAAAAAAAGGTACATGG + Intronic
1089641766 11:119852471-119852493 CAGAAAAAATTAACTGGACATGG + Intergenic
1089661228 11:119986954-119986976 CAAAAAAAATTAGTGGGACATGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1090151997 11:124394572-124394594 CAGAAAAGATACATGTTAGATGG + Intergenic
1090253227 11:125265286-125265308 CAAAAAAAAAAAAAGTTACAGGG + Intronic
1090389438 11:126378956-126378978 CAGAAAACATGAATGGAACTGGG - Intronic
1090480129 11:127060763-127060785 AATTAAAAATAAATGGGACAAGG - Intergenic
1091242009 11:134059277-134059299 CAGAAAAATTAAAATGCACATGG - Intergenic
1092201923 12:6590259-6590281 CACAATAACTAAATGGAACACGG + Intronic
1092729177 12:11512362-11512384 CAGAAAGAATAAATGATTCTAGG + Intergenic
1092914691 12:13179351-13179373 CAGAAAAAATAATTGCTACGAGG + Intergenic
1092990107 12:13888793-13888815 AAAAAAAAAAAAATGGTATAGGG + Intronic
1093264566 12:16987634-16987656 AAGATAAAATACATGGTATATGG - Intergenic
1093293281 12:17355740-17355762 AAGAAAATTTAAAGGGTACAAGG + Intergenic
1093382739 12:18514063-18514085 CAGAAAATATAAAAAGTACATGG - Intronic
1093391319 12:18627056-18627078 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1094786638 12:33856119-33856141 CACAAAAAATAAATGCTTGAGGG - Intergenic
1095520661 12:43061143-43061165 GAGAAATGCTAAATGGTACAAGG - Intergenic
1097280409 12:57842123-57842145 CAGAAAAAAAAAATTGTAGGAGG + Intronic
1097661903 12:62439452-62439474 CAGGAAAAATAATGAGTACAAGG - Intergenic
1098261353 12:68674815-68674837 TATAAAAAATAAATTGTTCAAGG - Intergenic
1098504304 12:71231579-71231601 CACAAAAAATAAATGCTTGAAGG + Intronic
1098698551 12:73591928-73591950 CAGAAAATATAATTGAAACATGG + Intergenic
1099004674 12:77222017-77222039 AAGAAAAAATCAATGGTAGAAGG - Intergenic
1099375160 12:81889891-81889913 TAGAAAAAATACATGGATCAAGG - Intergenic
1099409578 12:82308529-82308551 CAGCAATGATAAAAGGTACAGGG + Intronic
1099540562 12:83902892-83902914 AAAATAAAATAAATGATACAGGG + Intergenic
1099717531 12:86315272-86315294 CTGATTAAATAAATGGTACTTGG + Intronic
1099742269 12:86654713-86654735 GAAAAAAAAAAAAAGGTACAGGG - Intronic
1099823475 12:87745358-87745380 AAGAAAAAAAAAATGCTCCAAGG + Intergenic
1100219094 12:92484591-92484613 CACAAAAAATAAATTGGACATGG - Intergenic
1100730337 12:97460169-97460191 CAGAAAAAAAAAATTGTGAAAGG - Intergenic
1100900666 12:99236979-99237001 CAGGAAAAATAATGGGTACTAGG + Intronic
1101179875 12:102204376-102204398 CAGAAAAATTAGATTGTAGATGG + Intergenic
1101704268 12:107206657-107206679 CAGAAACAATAGACGGCACAAGG - Intergenic
1102499081 12:113338822-113338844 AAGACAAAATAACTGGTCCAGGG - Intronic
1102784040 12:115589374-115589396 CACAAAAAGGAAATGGTAAAAGG + Intergenic
1104026841 12:125033716-125033738 CAGAAAAACAAAACAGTACAGGG - Intergenic
1104102836 12:125630701-125630723 CAGAAAAAATATTGGGTACTAGG - Intronic
1104116293 12:125752130-125752152 CTGAAAAATTGAATGGTAAAAGG - Intergenic
1104400349 12:128470933-128470955 CAGAAAACATGCATGGTTCAGGG - Intronic
1104692142 12:130834364-130834386 AAAAAAAAAAAAAAGGTACAAGG + Intronic
1105550757 13:21393716-21393738 AAAAAAAAAAAAAAGGTACAAGG + Intronic
1106019354 13:25899880-25899902 GGGAAAAAATAGGTGGTACAGGG + Intronic
1106151392 13:27106691-27106713 TAAAAAAAATAAATGGTCTATGG - Intronic
1106251307 13:27983644-27983666 CAGAAAAAATATATGTAATATGG - Intronic
1106681056 13:32008124-32008146 CAGTAAAAATAAAATGTTCACGG + Intergenic
1107456138 13:40556454-40556476 CAGAGAAAATAAATCAAACAAGG + Exonic
1107747094 13:43521853-43521875 TACAAAAAATAAATGCTACAAGG + Intronic
1107884581 13:44864732-44864754 CACAAAAAATAAAAGGTTCCTGG + Intergenic
1108192412 13:47955678-47955700 CAGGAAAAAAATTTGGTACAAGG - Intronic
1108547140 13:51507352-51507374 AAGAAAATATAAACGGTCCAAGG - Intergenic
1108616850 13:52141665-52141687 CAGAATAATGAAATGGAACAGGG - Intronic
1108649976 13:52468227-52468249 CAGAGAAAATAAAACTTACATGG + Intronic
1108768598 13:53666417-53666439 CATAAAAAATAAATGTCAAAAGG - Intergenic
1108778250 13:53794355-53794377 CTGAAAAGTTATATGGTACATGG - Intergenic
1108843694 13:54652388-54652410 CATTAAAAAAAAATGGTACTAGG - Intergenic
1108907336 13:55494414-55494436 CAGTAAAAACAAGTGGTGCATGG - Intergenic
1109325621 13:60864175-60864197 CAGTAAAAATAACAGGTACTAGG - Intergenic
1109580441 13:64324981-64325003 CAGAAAAAATAGATGTTGTAAGG - Intergenic
1110073744 13:71212199-71212221 AAGAAGAAATAAATGGTTAAGGG - Intergenic
1110085305 13:71371446-71371468 CACAAAAAATGAATGGTTAATGG - Intergenic
1110153918 13:72290649-72290671 CAGAAAAAATAAACGGACCTTGG - Intergenic
1110162519 13:72395891-72395913 GAGAAAATATTAATGATACATGG + Intergenic
1110176315 13:72560268-72560290 CAGAAAATTTAAATTTTACACGG - Intergenic
1110234396 13:73201291-73201313 CACAATAAATATATGGGACAAGG + Intergenic
1110307607 13:74007863-74007885 GAGAACAAACAACTGGTACATGG + Intronic
1110559952 13:76900213-76900235 CATAAGAACTAAATGATACAAGG - Intergenic
1110621157 13:77597304-77597326 CAGAAAAAACAAATGCTGCAAGG + Intronic
1110729374 13:78862236-78862258 CAGAAAGAATAAAAGGTATAGGG - Intergenic
1110975144 13:81822995-81823017 GAAAAAAAATAAATGTTTCAGGG + Intergenic
1111790617 13:92850603-92850625 AAGAAAAAAAAAATCATACAGGG + Intronic
1111916796 13:94369344-94369366 CAGAGGAAATAAAGGGTCCAGGG + Intronic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112304750 13:98263834-98263856 CACTAAAAATAAATGGGAAAAGG - Intronic
1112948846 13:104964526-104964548 TAGAAAAGATAAATGGAAAATGG - Intergenic
1112993073 13:105537560-105537582 TAAAAAAAATAACTGTTACAGGG + Intergenic
1113270410 13:108667748-108667770 CACAAAAAATAATTGGTGCCAGG + Intronic
1113358575 13:109607142-109607164 CAGAAAAAATATTTGGTACTAGG - Intergenic
1114393641 14:22337153-22337175 CAGAGAAAATAAATGTGAGAAGG - Intergenic
1114777526 14:25501307-25501329 AAGAAAAGAAAAATGCTACATGG - Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115402352 14:32976407-32976429 AATAAAAAATAAATTTTACATGG - Intronic
1115590061 14:34855736-34855758 CAGAAAAATTAAAAGGTAGCTGG + Intronic
1116067746 14:40005661-40005683 CAGAAAAAAAAAATGGTATCGGG - Intergenic
1116269818 14:42748768-42748790 CAGAAAAACAGAATGGTAAACGG - Intergenic
1117987866 14:61406193-61406215 CAGGAAAAAAAAAATGTACAGGG + Intronic
1118100094 14:62588902-62588924 CACACAGAATAAATGGTACAGGG - Intergenic
1118485686 14:66212668-66212690 AAGAAAAAATAAATTGTTCTTGG - Intergenic
1118757628 14:68856318-68856340 CAGAGAAAAGAAATGTCACATGG + Intergenic
1118791363 14:69096183-69096205 CACATAAAATAAATGGTTAATGG - Intronic
1119102458 14:71892665-71892687 GAGCAAAAAGAAATGGTAAATGG + Intergenic
1119239393 14:73046376-73046398 GAGAAAAAATAAATGGTGGTGGG - Intergenic
1119796545 14:77403035-77403057 CAGAAAAAAAAAAGAATACAAGG + Intronic
1119950621 14:78740374-78740396 CAGAAAAAAAAAAGGAGACAAGG - Intronic
1119988541 14:79168374-79168396 TAGAAAAAATAGATAGTATAGGG + Intronic
1120208531 14:81611850-81611872 AGGAAAAAAAAAAGGGTACAGGG + Intergenic
1120334004 14:83130349-83130371 CAAAATAAATAATTGTTACATGG + Intergenic
1120442063 14:84553923-84553945 CAGGAAGACTAAATGGTCCATGG + Intergenic
1120877748 14:89390656-89390678 CAGAAAATAAAAATGGCCCAAGG + Intronic
1121529029 14:94639772-94639794 TTGAAAAAACAAATGGTTCATGG - Intergenic
1121659360 14:95623502-95623524 CAGAAAAAGCAGATGGTGCAGGG + Intergenic
1122642940 14:103171748-103171770 GGAAAAAAATAAATGTTACAGGG + Intergenic
1122677263 14:103425863-103425885 CAGAAAAAATCACTGCAACAAGG - Intronic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123487160 15:20751509-20751531 AAGAAAAAATACATTTTACACGG + Intergenic
1123543649 15:21320568-21320590 AAGAAAAAATACATTTTACACGG + Intergenic
1123770832 15:23526709-23526731 CAGAAAAAAAAAATGGAACTTGG - Intergenic
1124242548 15:28042177-28042199 CACAGTAAATAAATGATACAGGG + Intronic
1124548429 15:30654523-30654545 AAGAAAAAATAAAAGGGAAAGGG - Intronic
1124713918 15:32040553-32040575 TATAAGAAATAAATGGTACAAGG - Intronic
1125016273 15:34939050-34939072 CAGAAAAAAGAAAACGTTCACGG - Intronic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1125409085 15:39385967-39385989 AAGAAAAAATAAAAGGTATAAGG - Intergenic
1125434514 15:39630673-39630695 CAGAGAAATTGAATGGTCCAGGG + Intronic
1125694687 15:41625384-41625406 GAGAAAAAAAAAATTGAACAAGG + Intronic
1126130371 15:45335143-45335165 AAAAAAAAGTAAATGGTAAATGG + Intergenic
1126805003 15:52339521-52339543 AAGAAAAAAAAAAAGGAACAAGG + Intronic
1127280376 15:57485887-57485909 CAGAAGAAAGAAATGGCACGTGG - Intronic
1127592247 15:60436880-60436902 CAGATAAAATCAAATGTACAGGG + Intronic
1128844259 15:70875844-70875866 GAGAAAAAATTATTGGGACATGG - Intronic
1129023327 15:72544666-72544688 CAGAGGAAATAAAAGCTACATGG - Intronic
1129222953 15:74144155-74144177 CTGAAAAGATACATGGTACCAGG - Intergenic
1129478543 15:75804582-75804604 CAAAAAAAAAAAAAAGTACATGG + Intergenic
1129615764 15:77097944-77097966 CTGGGAAAATAAATGGAACATGG - Intergenic
1129782728 15:78284483-78284505 CATAAAAAATAAAATGTCCATGG - Intronic
1130374451 15:83315976-83315998 CAGAAAAAATATAAGGTAGCTGG - Intergenic
1130771517 15:86928631-86928653 CAGAAAACATGCATGGTACTTGG - Intronic
1131334386 15:91533620-91533642 AAGGAAAAATAAATGCTAAAGGG + Intergenic
1131735615 15:95328243-95328265 TAGAAAAAAGAAATGGGAAAAGG + Intergenic
1131759584 15:95606063-95606085 CAGAAAAGCAAAATGGTAAAAGG + Intergenic
1131923298 15:97353938-97353960 GAGAAAAAATAAATAGGGCAGGG + Intergenic
1132016484 15:98321850-98321872 CAGAAAAAAAAAATAGCACTAGG + Intergenic
1202951967 15_KI270727v1_random:47690-47712 AAGAAAAAATACATTTTACACGG + Intergenic
1132504454 16:300342-300364 AAGAAAAAATTAATGGGACATGG - Intronic
1134126239 16:11618165-11618187 CAGAATAAATAAATGGGTTATGG - Intronic
1134357520 16:13497821-13497843 AAGAAAAGATAAATGGTGCTGGG + Intergenic
1134402573 16:13923302-13923324 CAGGCTAAATAACTGGTACATGG + Intronic
1135411744 16:22240108-22240130 AAAAAAAAAAAAAAGGTACAGGG + Intronic
1135772213 16:25226195-25226217 CACAAAAAATAAATGCTTGAGGG - Intronic
1135959777 16:26985959-26985981 CACAGAGAATAAATGGTAAATGG + Intergenic
1137370429 16:47900409-47900431 CAAAAAAAAAAAATGATAAAGGG + Intergenic
1137813354 16:51374423-51374445 CAGAAAAAAAAGATATTACATGG + Intergenic
1138009511 16:53364368-53364390 AAGAAAAAATAAAGGGAAGATGG - Intergenic
1138049293 16:53759715-53759737 AAGAAAAAAGAAATAATACAGGG + Intronic
1138807753 16:60110967-60110989 CAGATAAAATAAACGTGACAAGG + Intergenic
1139021088 16:62750419-62750441 CAGAATTAATAATTGTTACAAGG - Intergenic
1139730697 16:68942322-68942344 CAAAAAAAAAAAAAGTTACATGG + Intronic
1140606098 16:76540419-76540441 GAGAAAAATAAAATGATACAAGG + Intronic
1140648538 16:77062232-77062254 CAGAAAAAAAAAATCATACCTGG - Intergenic
1140748126 16:77999065-77999087 CAGAAAAATTGGATGATACACGG + Intergenic
1141837603 16:86552979-86553001 CAGAAAAAAAAAAGGTTACTCGG - Intronic
1145127913 17:20317009-20317031 TTGTAAAAATAAATTGTACATGG - Intronic
1146105013 17:30026953-30026975 AAAAAAAAAAAAAAGGTACAAGG - Intronic
1146721229 17:35125079-35125101 CAGAAAAAAGAAATGTTAAGTGG + Intronic
1147383937 17:40071035-40071057 AAGAACAAAGAAATGGGACAGGG - Intronic
1148247447 17:46043304-46043326 CAGGAAAAAAAAAAGGGACAGGG + Intronic
1148453054 17:47793222-47793244 GAGAAAAAAAAATTGGGACATGG + Intergenic
1148730489 17:49832420-49832442 CAGAAGAAAAAAGTGGTAAAAGG - Exonic
1148988158 17:51642097-51642119 CACAAACAATAAATGATAAAAGG + Intronic
1149366582 17:55951517-55951539 AAGAGAAAATAAATTGTGCAGGG - Intergenic
1149471052 17:56915319-56915341 CATAAAAGGTAAATGGTAAAAGG - Intergenic
1150302821 17:64060315-64060337 CAAAAAACATAAATGGTTAAGGG - Intronic
1150422045 17:65045712-65045734 AAGAAAGAAGAAATGGTACAAGG + Intronic
1150619237 17:66796939-66796961 CAGAACAAATAAAGAGTAAAGGG - Intronic
1150646079 17:66978361-66978383 CCCAAAAAATACGTGGTACATGG + Intronic
1151133152 17:71919220-71919242 CAGAAAACACTGATGGTACAGGG + Intergenic
1151794528 17:76334737-76334759 GAGAAAAAATAAAAGGTAACTGG - Intronic
1152529542 17:80909221-80909243 AAGAAAAAAAAAATGGAAGAAGG - Intronic
1153062991 18:1013295-1013317 AAGAAAAAATACGTGGTTCATGG - Intergenic
1153078428 18:1192628-1192650 CAGGAAAAATAATGGGTACTAGG + Intergenic
1153450033 18:5216888-5216910 AAAAAAAAATAAATAATACATGG - Intergenic
1153567468 18:6432951-6432973 CAAAAGAAATAAAAGGTAGAAGG - Intergenic
1153759375 18:8315947-8315969 AATAAAAAATAAATGGAACCTGG - Intronic
1154125409 18:11688695-11688717 CAGCAAATATAAATAGTACATGG + Intergenic
1154352441 18:13596135-13596157 CAGAACAAAAAAAAGTTACAAGG - Intronic
1154408774 18:14123416-14123438 AATCAAAAATAACTGGTACAGGG + Intronic
1155363906 18:25031612-25031634 CAGATAAAATATATGAAACAAGG + Intergenic
1155635598 18:27951481-27951503 CAGAAATAAAAAAGTGTACATGG + Exonic
1155883080 18:31174511-31174533 CAGTAAAAGTAAATGTTAAAAGG + Intergenic
1156221195 18:35053972-35053994 GAGGAAAAATAAATGTAACAAGG + Intronic
1156680504 18:39582855-39582877 AAGAAAAAAAAAGTGATACAAGG - Intergenic
1156877176 18:42028829-42028851 CATAAAAACTAAATGCTATACGG - Intronic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1158162017 18:54495645-54495667 AACAAAAAATAAATGCTAAAAGG - Intergenic
1158376108 18:56869785-56869807 CAAAAAAATAAAATTGTACATGG - Intronic
1158602671 18:58868022-58868044 GAGAAGAAATAAATGGGAGATGG - Intronic
1158759219 18:60364841-60364863 CAGGAAAAATAACGGGTACCAGG - Intergenic
1159032028 18:63241268-63241290 CAGAAAACATAAATGTTAAAGGG + Intronic
1159270586 18:66144241-66144263 CAGAAAAAGTAAATGCTAAAAGG + Intergenic
1159730884 18:72026047-72026069 CAGAAAGAATAAATGTTTGAGGG - Intergenic
1159843901 18:73435882-73435904 CAGAAAGAAAAAATGATATATGG + Intergenic
1159979356 18:74757910-74757932 CAGAGAAAATAAATGTTAAAAGG - Intronic
1163507008 19:17713632-17713654 CAAAAAAAATAAAAGTTAAAGGG + Intergenic
1163781818 19:19254214-19254236 AAAAAAAAAAAAATGGTAAATGG + Intergenic
1164133328 19:22386282-22386304 TAATAATAATAAATGGTACAGGG - Intergenic
1164165484 19:22670470-22670492 TAATAATAATAAATGGTACAGGG + Intergenic
1164238794 19:23365300-23365322 AAAAAAAAAAAAATGCTACATGG + Intronic
1164439420 19:28261317-28261339 CAGAAAAAATAAAAATTTCAAGG - Intergenic
1164588954 19:29495686-29495708 AAAAAAAAAAAAATGGCACATGG + Intergenic
1164782189 19:30901822-30901844 CAGTAATAATAAATCGTAAAGGG + Intergenic
1165684077 19:37802930-37802952 CAGAAAAAGTAAATGTTGTATGG - Intronic
1167681277 19:50923130-50923152 CTTAAAAAAAAAATGGTGCAGGG + Intergenic
1168310708 19:55458928-55458950 CAAAAAGAAAAAATAGTACAGGG - Intronic
925020064 2:562202-562224 CAAAAACAATAAATGGTGGAGGG - Intergenic
925292907 2:2760251-2760273 CAGAAAAAATAAAGTGACCATGG + Intergenic
925523479 2:4774103-4774125 CAGAAAAAAAAAATAGGAAATGG + Intergenic
926046935 2:9716849-9716871 CAAAAAAAATAAGTGGTAGTGGG + Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927235279 2:20868085-20868107 CAAAAAATAAAAATAGTACAAGG - Intergenic
927617359 2:24613073-24613095 AAGAAAAAAAAAATATTACAGGG - Intronic
928026404 2:27742963-27742985 CATCAAAAATAAATGGTGGAGGG - Intergenic
928536396 2:32245635-32245657 CACAAAACATAAATGGTTGAAGG + Intronic
928570873 2:32607014-32607036 AAAAAAAAAAAAATAGTACATGG + Intronic
928739544 2:34334002-34334024 CACAAAAAATAAATGTTTGAGGG + Intergenic
928902405 2:36333947-36333969 CATAAAAAATCACTGGTATAGGG - Intergenic
929149794 2:38737256-38737278 CAAAAATAAAAAATTGTACAAGG + Intronic
929365609 2:41152722-41152744 AGGAAAAAATAAATGAGACAAGG + Intergenic
929660206 2:43776341-43776363 CACAAAAAAGAAATGTTTCAGGG + Intronic
929697778 2:44133889-44133911 CAGAAGAAATAATTCGTCCAAGG - Intergenic
930221624 2:48752252-48752274 AAGAAAAAAAACAAGGTACATGG - Intronic
930334054 2:50023421-50023443 CAGAAAAAAAAAATGACACCAGG - Intronic
930361112 2:50381120-50381142 CAGAATGAATGAATGGAACATGG + Intronic
930590335 2:53319583-53319605 CAGGAAAAATAATAGGTACTAGG - Intergenic
930825007 2:55687980-55688002 AAAAAAAAATAGATGGTACATGG - Intronic
931190413 2:59995058-59995080 CTGTAAAAATAAAAGGTACAAGG - Intergenic
931219429 2:60276030-60276052 ATGAATAAATAAATGGCACAGGG - Intergenic
931226926 2:60339819-60339841 TAGAAAAATTAAATTGTTCAAGG + Intergenic
931725965 2:65110964-65110986 AAGAAAAAATAATTGCTGCAAGG + Intronic
932125113 2:69138118-69138140 AAGAAAAAAAAATTGGTAGAGGG + Intronic
932507440 2:72249258-72249280 CTCAAAAAATAAAAGGGACAAGG - Intronic
933317479 2:80733228-80733250 AAGCAAAAATACATGGTACAGGG + Intergenic
933372907 2:81440141-81440163 CAGGAAAAATAATAGGTACTAGG + Intergenic
933920803 2:87042873-87042895 GAGAAAAAACAAATTTTACAAGG - Intergenic
933930822 2:87150913-87150935 GAGAAAAAACAAATTTTACAAGG + Intergenic
934002195 2:87727026-87727048 GAGAAAAAACAAATTTTACAAGG + Intergenic
935169366 2:100598943-100598965 TAGAAAAAATAGATTATACAAGG - Intergenic
935300282 2:101687944-101687966 AAGAAAAAAGAAATGATGCAAGG - Intergenic
935508280 2:103935495-103935517 AAGAAAAGAAAAAAGGTACAAGG + Intergenic
935710910 2:105897212-105897234 TAGAAAAAATAATTGGTAGTAGG - Intergenic
935843739 2:107142118-107142140 CACAATAAAAAAATGATACAGGG - Intergenic
935957549 2:108392850-108392872 CACAAAGAATAAATGCTAGAGGG - Intergenic
936362299 2:111814529-111814551 GAGAAAAAACAAATTTTACAAGG - Intronic
936628768 2:114177514-114177536 CAAAAAAAAAAAATGGAAGAAGG - Intergenic
936671918 2:114666028-114666050 CAGAAAAAAATGATGGTACTTGG - Intronic
936791334 2:116157040-116157062 CAGAAAAAACAATTGATAAAAGG + Intergenic
936878234 2:117218181-117218203 CAGAAATAATAAATAATACTTGG + Intergenic
937639386 2:124194166-124194188 CAGAGAAAATAAATGGGGGAGGG - Intronic
937733472 2:125261592-125261614 CAGAAAAAAGAAGTGATGCAGGG - Intergenic
938056973 2:128223119-128223141 CAGAGAGAATAGATGGTAAATGG + Intergenic
938857825 2:135333236-135333258 GAGAAAATATAAACTGTACAAGG + Intronic
938894421 2:135736190-135736212 CAAACAAATAAAATGGTACAGGG - Intergenic
939035125 2:137121963-137121985 CAGACAAAATAGAAGGTATAAGG + Intronic
939126479 2:138183758-138183780 TAGAAAAAATAAATCACACAGGG - Intergenic
939358410 2:141134725-141134747 CAAAAAAAAAAAATGAAACAAGG + Intronic
939377208 2:141384221-141384243 CAGGAAAAAAAAATGTTAAAAGG + Intronic
939741027 2:145906465-145906487 CAGGAAAAAAAAAAGGGACAGGG + Intergenic
940325726 2:152423152-152423174 CACAAAAAATAAATGCTTCAGGG - Intronic
940518958 2:154718105-154718127 CAGGAAAAACTAATGGCACATGG + Intronic
940595366 2:155784588-155784610 CAGGAAAAATAATAGGTACTGGG + Intergenic
940615114 2:156039567-156039589 CAGACAAAATATCTAGTACAAGG + Intergenic
940622764 2:156133506-156133528 CAGATTAAAGAAATGGCACATGG + Intergenic
941413286 2:165186997-165187019 CAGAAAGACTAAATGGATCAAGG - Intronic
942391289 2:175495939-175495961 CACAACAAATAAATGCTTCAGGG - Intergenic
942557194 2:177184076-177184098 CAGATAAAGTAAATGGGATAAGG + Intergenic
942941628 2:181625371-181625393 AAAAAAAAATAAATGGGACCAGG + Intronic
943117264 2:183689380-183689402 CAGAAAAAAAAAATGGCAGGAGG - Intergenic
943145003 2:184032202-184032224 CATAAATAAAACATGGTACAAGG + Intergenic
943154561 2:184157713-184157735 CACAAAAGATAAATGCTTCAGGG - Intergenic
943284790 2:185983910-185983932 CAGAAAACAAAAATTGTACTTGG - Intergenic
943403615 2:187450673-187450695 CAGAAAAAATAAATGGTACAAGG + Intergenic
943540902 2:189212715-189212737 AAGAAAAATTGAATGGTAGATGG + Intergenic
943715491 2:191147694-191147716 GAAAAAAATTAAATGGTATAAGG + Intronic
943864669 2:192914528-192914550 CACAAAAAATAAATGCTTGAGGG + Intergenic
944341787 2:198610072-198610094 AAAAAAAAATTAAAGGTACAGGG - Intergenic
944398278 2:199295313-199295335 TATAAAAAATAAATAATACACGG + Intronic
944963020 2:204898162-204898184 AAAAAAAAAGAAATGGTCCATGG - Intronic
944963031 2:204898277-204898299 ATAAAAAAATAAATGCTACAAGG - Intronic
945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG + Intergenic
945126037 2:206511140-206511162 AATAAAAAATAAATAGTACAAGG - Intronic
945253733 2:207786392-207786414 CAGAAAAAAAAAAAGGAGCATGG + Intergenic
945270357 2:207932243-207932265 CAGTAGAAACAAATAGTACATGG + Intronic
945394681 2:209304199-209304221 CTGAAAAACTAAATGGAATAAGG - Intergenic
945702365 2:213188200-213188222 TGGAAAAAAAAAATGGTATATGG - Intergenic
946065006 2:216979568-216979590 CAAAAAAAAAAAATGATAAAGGG - Intergenic
946090019 2:217213541-217213563 CAGAAAAAATAATGGGTACCAGG + Intergenic
946926946 2:224635669-224635691 AGGAAATAATAAATGTTACAAGG + Intergenic
946990725 2:225326577-225326599 CAGGAAGAATAAATGGAACTGGG + Intergenic
947060143 2:226155289-226155311 CAGAAAAAAAAAATGATGAATGG - Intergenic
947272603 2:228353289-228353311 GACAAAAAAGAAATAGTACAAGG - Intergenic
947664788 2:231897718-231897740 CAGAAAAAATAAACAGTTCCAGG + Intergenic
948556600 2:238815630-238815652 CATAAAAAAGAAATTGTCCAAGG + Intergenic
948871494 2:240801260-240801282 CAGAGAATATAAATGGAAAATGG + Intronic
948936432 2:241168119-241168141 CAGAAAAAAAGAATGGAACAGGG - Intronic
1168966242 20:1900083-1900105 AAGAAAAAAAAAAAGCTACAAGG - Intronic
1169302626 20:4457419-4457441 CAGGAAAAATAATGGGTACTAGG + Intergenic
1169818890 20:9687420-9687442 CAGTAAAAATAAAGAGCACAAGG - Intronic
1169902185 20:10564780-10564802 CAGTAAAAATTAATGGTATAAGG + Intronic
1170066068 20:12311844-12311866 TAGAGAAAGCAAATGGTACAAGG - Intergenic
1170096160 20:12648172-12648194 CAGAGACAATAAATGGTAAGTGG + Intergenic
1170123197 20:12933989-12934011 CAGAAAAGACAAAAAGTACAAGG - Intergenic
1171046999 20:21818224-21818246 GTGGAAAAATAAATGGAACAAGG + Intergenic
1171222568 20:23412989-23413011 CCAAAAAAATAAAGTGTACATGG + Intronic
1171495499 20:25552201-25552223 AAGAAAAAAAAAATGATAAAAGG - Intronic
1172254842 20:33508538-33508560 CAGGAAAAATAACAGGTACTAGG - Intronic
1172761015 20:37322107-37322129 AATAAAAAATAAATGGTGCTTGG - Intergenic
1172925757 20:38533328-38533350 CAGAAAATAAAAATGTTTCAGGG - Intronic
1173001346 20:39108156-39108178 CAGGAAATATAAAGGGTCCAGGG - Intergenic
1173920177 20:46738523-46738545 AAGAAAAAATGAATGAAACAAGG + Intergenic
1173949845 20:46982596-46982618 CATAAAAGAAACATGGTACATGG - Intronic
1174385311 20:50185278-50185300 AAAAAAAAAAAAATGGAACATGG - Intergenic
1174729436 20:52901210-52901232 GAGAAAAAGATAATGGTACATGG - Intergenic
1175254568 20:57632348-57632370 CAGAAAGAATAGATGGTAGCCGG + Intergenic
1175587401 20:60153160-60153182 AAGGAAAAATAAAGGTTACATGG - Intergenic
1175596092 20:60234415-60234437 CATTAAAAATGAATGGCACAAGG - Intergenic
1176975653 21:15318011-15318033 AAGAAAAAAGAAATGGAAAATGG + Intergenic
1177380408 21:20333855-20333877 CAGACAAAATATATGAAACAGGG + Intergenic
1177864930 21:26500966-26500988 TTGAAAATCTAAATGGTACATGG - Intronic
1180573030 22:16747757-16747779 AAAAAAAAAAAAAAGGTACAAGG - Intergenic
1181616201 22:24056357-24056379 CAGAAAAAATACACAGTACCTGG - Exonic
1182264947 22:29107202-29107224 AAAAAAGTATAAATGGTACACGG - Intronic
1182381034 22:29888177-29888199 AAGAAAAAATACATTTTACACGG - Intronic
1182491916 22:30678401-30678423 GAGAAAGGATAAATGTTACAAGG - Intergenic
1182720778 22:32397439-32397461 AAGAAAAAATAAATATTAAAAGG - Intronic
1182930057 22:34164963-34164985 AAGAAAAAATATATACTACAAGG - Intergenic
1183224664 22:36541341-36541363 CAGAAAAATTAAAGGGTTTATGG + Intergenic
1183887496 22:40896827-40896849 CAGAAAAAGTAAAAGTTACCAGG - Intronic
1184179681 22:42812082-42812104 AAGAAAAAATTAATGGGGCATGG + Intronic
949183601 3:1164725-1164747 CCTAAAAACTAAATGGCACAGGG - Intronic
949364752 3:3268855-3268877 CAGAGTAAATAAAGGGTATAGGG + Intergenic
949786914 3:7751966-7751988 CAGAAAAAATATCAGGTACTAGG + Intergenic
950237706 3:11338070-11338092 CAGAAAAAATACTAGGTACTAGG - Intronic
950997791 3:17522495-17522517 CAGAAAACATAAAGGGTCTATGG + Intronic
951019677 3:17768640-17768662 CACAAAAAATAGATGCTTCAGGG + Intronic
951073122 3:18355838-18355860 CAGAAAACTAAAATGGTACAAGG + Intronic
951167949 3:19505334-19505356 CAGAAAATATAATAGGTACTAGG + Intronic
951469549 3:23041628-23041650 CAGAATAAATAAGTGGTTAATGG + Intergenic
951618347 3:24573173-24573195 GAGAAAAAATACATGGAAGAAGG + Intergenic
951765692 3:26195868-26195890 GAGAAAAAATAATTTGTTCAAGG + Intergenic
952014149 3:28937296-28937318 CAAAAACAATAAATGGTGCTGGG + Intergenic
953022419 3:39123585-39123607 CATAAAAATTAAATGAAACATGG + Intronic
953075344 3:39564866-39564888 AAGAAAAAATAAATGGAAAAGGG - Intergenic
953087829 3:39689399-39689421 CACAAAGAATAAATGGTTGAGGG + Intergenic
953745135 3:45568336-45568358 CAGAAAAAATATTGGGTACTGGG - Intronic
953986122 3:47444470-47444492 CAAAAAAAATAAAGGGTTCCTGG - Intronic
954669683 3:52282953-52282975 GAAAAAAAATAAATATTACAAGG + Intronic
954954028 3:54503259-54503281 CAGAAAACATAAATGTTAAGGGG - Intronic
955049125 3:55391971-55391993 CAAAAAAAAAAAATGATAAAGGG + Intergenic
955123335 3:56083905-56083927 GGGAAAAAAAAAATGGAACAGGG + Intronic
955315636 3:57936675-57936697 AAGAAAAAAGAAAAGCTACAGGG + Intergenic
955470886 3:59284909-59284931 TAGAAAAAATAAATAGAACCTGG + Intergenic
955834068 3:63034836-63034858 CAGATCAAATGAATGGTAAATGG + Intergenic
955846622 3:63169939-63169961 AATAAAAAATAAAAGGTACTGGG + Intergenic
956633165 3:71336030-71336052 AAAAAAAAAAAAAAGGTACAAGG + Intronic
956980101 3:74626521-74626543 GGGAGAAAATAAATGATACATGG - Intergenic
957114827 3:76011610-76011632 CAGAAAAGATAAAAGGTTCAAGG + Intronic
957302368 3:78408909-78408931 GAGAAAAAATATATTGCACACGG - Intergenic
957345881 3:78960831-78960853 CACAAAATGAAAATGGTACAGGG + Intronic
957454717 3:80426724-80426746 GGAAAAAAATAAATGGTACTGGG - Intergenic
957846675 3:85745449-85745471 CACAACAAATAAATGGATCATGG + Intronic
957846716 3:85745902-85745924 CACAAAAAATAAATGGACCATGG - Intronic
958081530 3:88751815-88751837 CAGAAACAATAAATGGGGAAAGG + Intergenic
958159207 3:89794994-89795016 GAGAAAAAAAAAATGGGACAAGG - Intergenic
958178377 3:90025204-90025226 CAGAATAAATAAATACAACATGG - Intergenic
959345860 3:105193531-105193553 CACAAAAAATAAATTGGATAAGG + Intergenic
959995225 3:112673387-112673409 AAGAAAAAATAAATAACACATGG + Intergenic
960018246 3:112917650-112917672 CACAAAAAAAAAATGATAAAGGG + Intergenic
960068862 3:113406242-113406264 CAATAAAAATAAATGCCACATGG + Intronic
960132486 3:114072133-114072155 AAAAAAAAATGAATGATACATGG - Intronic
960289901 3:115871343-115871365 CAGAAAAAAAAATGGCTACAGGG + Intronic
960556132 3:119032771-119032793 CACAAATAATTTATGGTACAGGG - Intronic
960741509 3:120838794-120838816 CAGAAAAAAAAAATCTTTCAAGG - Intergenic
960824001 3:121763638-121763660 GAGAAACAAAAAATGGTCCAAGG - Intergenic
961744234 3:129053570-129053592 GAGGAAAAATGAATGGTAAACGG + Intergenic
962394211 3:135000819-135000841 CACAAAAAATCAATGGAACTGGG - Intronic
962975755 3:140444431-140444453 AAAAAAAAAAAAATGCTACATGG + Intronic
963334532 3:143958112-143958134 AAGAAGAAATAAAAGGTAAAAGG - Intergenic
963676741 3:148321908-148321930 CAGAAAAAATAAAGGAAAAAGGG + Intergenic
963821294 3:149897415-149897437 AAGAAAAAATAAGTGATAAAGGG - Intronic
964130428 3:153280692-153280714 CAGAAAAAATAAGTAACACATGG + Intergenic
964157608 3:153604838-153604860 AAGAAAAAAGAAATGGTAAACGG - Intergenic
964303133 3:155311005-155311027 CATAAAAAATAAGTGGGAAATGG + Intergenic
964357917 3:155867450-155867472 CAGACAAAATATATGAAACAGGG + Intergenic
964423465 3:156529153-156529175 CAACAAAAAGAAATGGTATACGG + Intronic
964963781 3:162463712-162463734 CAGAAAAAATAATAGGTACTAGG - Intergenic
965003881 3:162991190-162991212 TAGAAAAAATAAAAGTGACAAGG + Intergenic
965870350 3:173257123-173257145 CAGAAAAAATATATATCACAGGG + Intergenic
966032112 3:175362126-175362148 CAAAAACAATAAATGGGAAAAGG - Intronic
966077665 3:175957492-175957514 TAGAAAAAATAAGAGGTCCAAGG + Intergenic
966436443 3:179889702-179889724 CAGAAAAAATAAAAAGCACTGGG - Intronic
967097217 3:186186961-186186983 CAGAAAGAATAGTTGGTTCATGG + Intronic
967314099 3:188134497-188134519 CAGGAAAAATAATGGGTACTAGG + Intergenic
967452226 3:189638378-189638400 TAGAAATAATACAAGGTACAAGG + Intronic
967550450 3:190788661-190788683 CAGAAAAAATATATGCTTTATGG - Intergenic
967753557 3:193142397-193142419 CTGAAAAAATAACTAATACAAGG - Intergenic
967945774 3:194802527-194802549 TATGAAAAAAAAATGGTACATGG - Intergenic
968218231 3:196912703-196912725 AAGAAAAAATAAAAGGTACTAGG + Intronic
968355867 3:198106232-198106254 GAGAAAAAATAAAAGGAAGAGGG - Intergenic
968364820 3:198176050-198176072 TAGAAAAGATAGATGGTAAATGG + Intergenic
969047896 4:4350882-4350904 CAAAAAAAAAAAAGAGTACAGGG + Intronic
969370074 4:6726419-6726441 AAAAAAAAAAAAATGGAACAGGG - Intergenic
969784092 4:9439031-9439053 GAGAAAAAAAAAATAATACAGGG - Intergenic
970213431 4:13733933-13733955 CAGAAAAAATAAATGAATCATGG + Intergenic
970519314 4:16866008-16866030 AAGAAAAATAAAATGGGACAAGG - Intronic
970937486 4:21590576-21590598 AAGAAAAAATAAAAGGTTTAGGG + Intronic
971524411 4:27598501-27598523 TAGACAAAATAAATAGTACTGGG + Intergenic
971884046 4:32420248-32420270 CAGAAAAGATACTTGGTACTTGG + Intergenic
972009828 4:34163949-34163971 CACAAAAAATAAATGCTTGAGGG + Intergenic
972143585 4:35992953-35992975 CTGCAAAAATAAATGGTAGTTGG - Intronic
972224090 4:36991871-36991893 TAAAAAAAAAAAAAGGTACATGG - Intergenic
972704264 4:41526313-41526335 AAGAAAATATAAATGATACAGGG - Intronic
972902129 4:43698365-43698387 CAGGAAAAATAACTAGTACTAGG - Intergenic
973829979 4:54748926-54748948 CGGAAAAAAAAAAAGGGACAGGG - Intergenic
974118105 4:57605804-57605826 CAGAAAAAATATATGGCATGAGG - Intergenic
974165743 4:58199249-58199271 CAGGAAAAATAAATTATCCATGG - Intergenic
974505619 4:62767328-62767350 CATAAAAAGAACATGGTACAAGG + Intergenic
974871453 4:67648566-67648588 CAGCAGAAATAATTGGCACAAGG - Intronic
975288986 4:72654563-72654585 AAGATAAAATAAATGGGTCAAGG - Intergenic
975774446 4:77769298-77769320 CAGGAAACATAAAAGGTATAGGG + Intronic
975791449 4:77956891-77956913 TAGAAATTATAAATGGTAAAGGG + Intergenic
976141808 4:82000931-82000953 AAGAAAACACAAATGCTACAAGG + Intronic
976314051 4:83640504-83640526 CAGAATACATGATTGGTACAAGG - Intergenic
976840772 4:89430217-89430239 AAAAAAAAATAAGTGCTACAGGG - Intergenic
977475124 4:97496820-97496842 CAGACAAAATGAATGCCACATGG - Intronic
977830908 4:101591462-101591484 CAGGAAAAATAATGGGTACTAGG + Intronic
978560263 4:110025899-110025921 AAGAAAAGAAAAATGGCACATGG - Intergenic
978912044 4:114075507-114075529 ATGGAAAAATAAATGGTACTGGG + Intergenic
978912875 4:114085360-114085382 CTGAAAAAATAAAGTGTAGATGG - Intergenic
978957259 4:114629477-114629499 CAGAAAAAATAAATTCTCTAAGG + Intronic
979108174 4:116714737-116714759 CAGAGAAATGAAATGATACAAGG + Intergenic
979802640 4:124929483-124929505 CAGAAATAATAAATAGTATGAGG + Intergenic
980095420 4:128484994-128485016 CAGAAAAGATAAATTGGAGAGGG - Intergenic
980337019 4:131488835-131488857 CAGAAAAAGTAACTGTTATAAGG - Intergenic
980807181 4:137828751-137828773 CATAGAAAATAAATGGAAAATGG + Intergenic
981122799 4:141071879-141071901 AATAAAAAATAAATGTTACCAGG - Intronic
981288911 4:143051239-143051261 CAGAAAAGAAAAATGGCACATGG + Intergenic
981333909 4:143545562-143545584 CAGAAAAACTATTGGGTACAAGG + Exonic
981399615 4:144298451-144298473 TTCAAAAAATAAAAGGTACAAGG + Intergenic
981930727 4:150186285-150186307 TTTAAAAAATAAATGGTAAAAGG + Intronic
981973947 4:150700415-150700437 CAAACAAAAAAAATGGTACAGGG + Intronic
982475013 4:155839825-155839847 CAGAAAAAAAAGATGGTAGATGG + Intronic
982602141 4:157465589-157465611 CAGAGCAAATAAATATTACATGG + Intergenic
982696285 4:158605287-158605309 CAGAAAAAATAAGTGTTACCTGG - Intronic
983274005 4:165595741-165595763 AAGAAAAATTTAATGATACAGGG + Intergenic
983357289 4:166680097-166680119 GTGAAAGAATAAATGATACAAGG - Intergenic
983608198 4:169613980-169614002 AAAAAAAAATCAATTGTACAGGG - Intronic
983803846 4:171968813-171968835 CACAAAAAAAAAATAGAACAAGG - Intronic
984219732 4:176958589-176958611 AAGAAAAAATATATGGAACTTGG - Intergenic
984541048 4:181037255-181037277 CACAAAAAATAAATGCTTGAGGG - Intergenic
985794467 5:1952104-1952126 AAGAAAGAAAAAATGCTACATGG - Intergenic
986377491 5:7147410-7147432 AAGGAAAAATAAATGAGACATGG - Intergenic
986621111 5:9675708-9675730 TAGAAATAATAAATGGGGCAGGG - Intronic
986865203 5:11978039-11978061 CAGAACAAATCAATGCAACAGGG - Intergenic
986973712 5:13370232-13370254 CAGAAAAAAAAATTGATAAATGG + Intergenic
987571497 5:19667872-19667894 CATAGAAAATAAATGGTAAATGG - Intronic
987608318 5:20168070-20168092 CACAAAAAATAAATGTGAAATGG - Intronic
987780408 5:22426996-22427018 GAGAAAAGATAAATGGGAGAGGG - Intronic
987912057 5:24160407-24160429 AAAAAAAAATAACTGGTAAATGG + Intronic
989740780 5:44768665-44768687 CAAAAAAAAAAAATTGTAAATGG + Intergenic
989741215 5:44774746-44774768 CACAAAAGATAAATGCTTCAGGG - Intergenic
989950178 5:50287910-50287932 CAAACAAAATCAATGGTACCTGG - Intergenic
990053330 5:51537041-51537063 CAGCTAAAATAAATTGTAAAGGG - Intergenic
990643227 5:57812451-57812473 AAGAAAAAATAAATGAGAGAAGG + Intergenic
991251931 5:64572438-64572460 AGGAAGAAATAAATTGTACAAGG + Intronic
991334091 5:65527239-65527261 CAGAAAAAATAGAATGTATAAGG + Intronic
991360111 5:65810978-65811000 CAAAAAAAATAAAGGGTATTTGG + Intronic
991375984 5:65967716-65967738 CACAATAAATAATTGGTATAAGG - Intronic
991438588 5:66622091-66622113 GAGAAAAAAAAAATGGAATATGG + Intronic
991467168 5:66925934-66925956 CAAAAAAAAAAAATTGTACTAGG - Intronic
991522508 5:67516353-67516375 AAGAAAAAGGAAATGGTTCAGGG + Intergenic
992169311 5:74086368-74086390 CTGAAAAAATGAGTGGGACAGGG - Intergenic
992495428 5:77288528-77288550 GAGAATAAATAAATTGTCCAGGG + Intronic
992589846 5:78283220-78283242 CAGAGTTAATAAATGGTACTTGG - Intronic
992810245 5:80380162-80380184 CAGAATAAAGAAATTGTTCAAGG + Intergenic
992979340 5:82151630-82151652 AAAAAAAAAAAAATGGTAAAAGG + Intronic
993202334 5:84831513-84831535 GAGAAAAAATAAAAGGAAGAGGG + Intergenic
993546888 5:89223222-89223244 CAGTAAAAAAAAATGATAAAGGG + Intergenic
993860916 5:93135958-93135980 CAGAAAAGATAAATGCAAAAAGG + Intergenic
994067553 5:95560297-95560319 CAGAAAAAAAAAAAGGTTCTAGG - Intronic
994236739 5:97371431-97371453 CAGAAAAAAAAAATTAGACATGG - Intergenic
994399466 5:99261126-99261148 CACAAATAATAAATGCTTCAGGG + Intergenic
994521144 5:100837530-100837552 CAGAATAAACATATGGTTCAAGG - Intronic
994575410 5:101572383-101572405 CAGATAAAACAAATGTCACATGG - Intergenic
994632047 5:102297979-102298001 CAGTAATAATACATAGTACATGG + Intergenic
994648663 5:102499975-102499997 CATTAAAAATGAATGGTACTGGG + Intergenic
994680875 5:102885991-102886013 GTGAGAAAATAAATGATACAAGG - Intronic
994916296 5:105983539-105983561 CAAAAAAAATAAATGGCATTTGG - Intergenic
994956100 5:106535139-106535161 CAGGAAAAATAATGGGTACTAGG - Intergenic
995040173 5:107578581-107578603 CAGAAAAAATAAATGATAAATGG + Intronic
995068223 5:107886915-107886937 CAAAAAAAAAAAAAGGAACAAGG + Intronic
995641361 5:114260996-114261018 CCAGAAAAATAAATGGTCCAGGG - Intergenic
995727416 5:115196041-115196063 CAGTGAAAATAGATGGCACACGG + Intergenic
995814873 5:116156869-116156891 TAGAAAAAATAAAGGGGGCAAGG - Intronic
995950906 5:117712727-117712749 CAGAAATAATAAAAGTTAGAGGG - Intergenic
995963273 5:117871887-117871909 CAGAAAAAAAAAATGGGAAGAGG + Intergenic
996019278 5:118573974-118573996 CAGGAAAAATAATGGGTACTAGG - Intergenic
996126522 5:119731544-119731566 CAGAAACAATAAATTGCAAATGG + Intergenic
996219541 5:120913315-120913337 CCAAAAAAAAAAAAGGTACATGG + Intergenic
996300763 5:121981545-121981567 AAAAAAAAAAAAAAGGTACAGGG - Intronic
997904013 5:137796404-137796426 GAGCAGAAATCAATGGTACAAGG + Intergenic
998578721 5:143346892-143346914 CAGAAATAGTGAATGGTATAAGG + Intronic
998689153 5:144567789-144567811 AAGAAAATATTAATGGTTCATGG - Intergenic
998775427 5:145595266-145595288 CCAAAAAAATAAATAGTGCAGGG - Intronic
999059820 5:148621702-148621724 CAGAAAAAATAGATTATCCATGG - Intronic
999834814 5:155358280-155358302 CAGAAACAAGCAATGGTAAAAGG + Intergenic
1000169698 5:158690059-158690081 CAGAAAAAAGAAATGAGAAAAGG + Intergenic
1000384962 5:160666589-160666611 CAAGAAAAATAAATGTTGCAAGG - Intronic
1000462312 5:161537893-161537915 CAGGATAAATAAATGGTATTAGG - Intronic
1001058645 5:168469862-168469884 AAGAAAAAATAAATGTTTCCAGG - Intronic
1001275959 5:170351854-170351876 CAAAAAAAAAAAAAGGCACACGG - Intergenic
1002335406 5:178474383-178474405 CATATAAAATAAATGGTAAAAGG + Intronic
1002577529 5:180183491-180183513 CAGAAAAAAAAAAAGATACAAGG + Intronic
1002831836 6:829083-829105 CAAAAAAAAGAAATGCTAAAGGG + Intergenic
1003690683 6:8350859-8350881 CAAAAAAAAAAAATGGAGCAGGG - Intergenic
1004083240 6:12417031-12417053 AAGAAAAGATATATGATACAAGG - Intergenic
1004174408 6:13327138-13327160 CTGATAAAATAGATGGCACAAGG + Intronic
1004319094 6:14618673-14618695 CAGAAAAGAAAAATGCTAGAGGG - Intergenic
1005267630 6:24128819-24128841 CAAAGAAAATAAATAGAACAGGG + Intronic
1005380557 6:25230015-25230037 CAGATAAAATAATTGGTATCTGG + Intergenic
1005480707 6:26252730-26252752 CAGAGAATATAAATAGTAAAGGG + Intergenic
1005879270 6:30042602-30042624 CAGAAAAAAAAAATGATCCTAGG - Intergenic
1006641002 6:35489905-35489927 AAGAAAAAATTAAGGGGACAGGG + Intronic
1006855891 6:37133083-37133105 AAGAAAAAGAAAAAGGTACATGG + Intergenic
1007660350 6:43481183-43481205 CAGAAATAGTAACTGGTGCATGG + Intronic
1008578553 6:52884362-52884384 CAGAGAAAATAAATTGTATTAGG + Intronic
1008639572 6:53447998-53448020 GAAAAAAAAAAAATTGTACATGG - Intergenic
1008907312 6:56693674-56693696 AAAAAAAAATATATGGTAGAGGG - Intronic
1009303317 6:62054985-62055007 CAGAAAAACTAAATTCTAGATGG + Intronic
1009483647 6:64192882-64192904 CAGTAAAGATCAATGGGACAAGG - Intronic
1009509647 6:64533439-64533461 CAGAAAAAATAAAAGCAGCAGGG + Intronic
1009804640 6:68587402-68587424 GAGAAAAAATAAAAGGCACGAGG + Intergenic
1009961339 6:70525841-70525863 CTGAAAAAACAAATTGTAAAGGG - Exonic
1010449412 6:75986105-75986127 CAAAAAAAACCCATGGTACATGG - Intronic
1010602412 6:77846497-77846519 GAGAAACAGTAAATGATACAAGG - Intronic
1011111478 6:83841593-83841615 CAGAAAAAAAGAAAGGTAAAAGG - Intergenic
1011621716 6:89249797-89249819 CAGAGTAAATAAATGGCTCATGG + Intergenic
1011881509 6:92033907-92033929 AAAAAAAAAAAAATGGTACCAGG + Intergenic
1012331384 6:97992921-97992943 CAGAAAAAAATAATGATACTTGG + Intergenic
1012719297 6:102721837-102721859 CAGAAGAAATAAAAGGTTAAAGG + Intergenic
1012720808 6:102741439-102741461 CAGAAAAAATAAATGGGACTTGG + Intergenic
1012734258 6:102919030-102919052 GAGAAAAAATAAGTAGAACAGGG + Intergenic
1012846979 6:104402820-104402842 CAGAAAACATAAACGCTAAAAGG + Intergenic
1013697125 6:112716533-112716555 AAGAGAAAGTAAATGGTACTTGG - Intergenic
1013944610 6:115706617-115706639 AAGAAAAAAAAAAAGATACAGGG + Intergenic
1013963137 6:115925772-115925794 AAGAAAAAATAAAAGGGAAAAGG - Intergenic
1014568700 6:122982820-122982842 CTGAAAAAATAAATGCTAAAGGG + Intergenic
1014568790 6:122983838-122983860 CTGAAAAAATAAATACTAAAGGG + Intergenic
1014653804 6:124074054-124074076 CAGAAAAGGTAAAAGGTTCATGG + Intronic
1014720625 6:124913403-124913425 CACAAAATATAAATGCCACATGG - Intergenic
1015350818 6:132216281-132216303 CACAAAAAATAAATAGTAGGAGG + Intergenic
1015629282 6:135215339-135215361 CAGAAACAATAAAAGGAACCTGG - Intronic
1016147962 6:140699818-140699840 CATAAAACATTAATGGTTCAGGG - Intergenic
1017158573 6:151343796-151343818 AAGAAAAAAGAAATAGTTCATGG + Intronic
1017684972 6:156904015-156904037 TTGAAAAAATAAAAAGTACAAGG + Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018139144 6:160809811-160809833 CTGAAAAAATAAGTGATTCATGG - Intergenic
1018246803 6:161831766-161831788 CAGAAAAAATAAGAGGTTCAGGG + Intronic
1018397449 6:163389553-163389575 CAGAAAAGAGGAAGGGTACAAGG - Intergenic
1020761508 7:12272664-12272686 CAGAATAAATAAACAGCACATGG - Intergenic
1021082965 7:16385455-16385477 CAGAAACAATAAAAGTTAGATGG + Intronic
1021377613 7:19927336-19927358 CATATAACAGAAATGGTACATGG - Intergenic
1021605422 7:22404934-22404956 CAGGATAAATAAATGGTAAATGG + Intergenic
1022972618 7:35531386-35531408 CAGAAAAGATAAATGCTTGAGGG + Intergenic
1023214201 7:37844261-37844283 TAAAGAAAATAAATGGTATAGGG - Intronic
1023480745 7:40631388-40631410 CAGGAAAAACAAATGTCACATGG - Intronic
1023589581 7:41766813-41766835 TAAAAAAAATAACTTGTACAGGG + Intergenic
1024477149 7:49825035-49825057 CAGAAAGAAAAAAAGATACAGGG - Intronic
1026016275 7:66673228-66673250 CAGATAAAATAGGTGGTTCAGGG + Intronic
1026172943 7:67970643-67970665 CAGAAAGAAGAAATGGGATAGGG - Intergenic
1026247138 7:68630931-68630953 CACAAAAAATAAATGCTTGAGGG - Intergenic
1026295408 7:69047700-69047722 AAGAGAAAATAAATGGATCATGG - Intergenic
1026525242 7:71147620-71147642 AAGAAAAAAGAAATGGTCCTTGG - Intronic
1026587943 7:71672037-71672059 AAAAAAAAAAAAATGGTACCTGG + Intronic
1027346078 7:77261233-77261255 CAGGAAAAATAATAGGTACTAGG - Intronic
1027835178 7:83232685-83232707 CAGAAATAATATATGATATATGG - Intergenic
1028205813 7:88015508-88015530 CAGAAAAGCTAAGTGGTAAAAGG + Intronic
1028209207 7:88052705-88052727 CAAAGAAAATAAATGTCACATGG - Intronic
1028975048 7:96903373-96903395 TAGGAAAAATAACTGTTACATGG + Intergenic
1028976614 7:96921858-96921880 CAAAAAAAAAAAAAGGTAGAGGG - Intergenic
1029058254 7:97769453-97769475 GAAAAAAATTAAATGGGACAAGG + Intergenic
1030134572 7:106234527-106234549 CAGAAAATATAAGCGGTCCAAGG + Intergenic
1030219948 7:107088124-107088146 CAGAGAAATTAACTGGTAGAAGG + Intronic
1030478075 7:110062867-110062889 CAGTAAAAATACATGGAGCAAGG - Intergenic
1030863348 7:114666241-114666263 CAGAAAAAATAAAAATTAAAAGG + Intronic
1030959785 7:115903163-115903185 AAAAAAAAAAAAATGGAACAAGG - Intergenic
1031519067 7:122740681-122740703 CATTAAAAATAAATTTTACATGG + Intronic
1031746736 7:125507824-125507846 AAGAAGAGATAAATGGTAGAAGG + Intergenic
1032233416 7:130097833-130097855 TAGAAAAAATAAAAAGTAGAAGG - Intronic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1032949594 7:136892459-136892481 AAGAAAAAAAAAATGATTCATGG + Intronic
1032971356 7:137167445-137167467 CTGACAAATTAAATGGTATATGG - Intergenic
1033085803 7:138340701-138340723 GAGAAAGGATAAATGTTACAGGG + Intergenic
1033634774 7:143201768-143201790 CATAAAAAATAACTGGAATACGG - Intergenic
1033922399 7:146410609-146410631 CAGGAAAAATAACTGTTACCAGG - Intronic
1033968763 7:147011501-147011523 CATAAAAACTAAATGTGACATGG + Intronic
1034009875 7:147518343-147518365 GAGAAAAAATAAATGAGAGAAGG + Intronic
1034030106 7:147752319-147752341 TAGAGAAAAAAAATGGTTCAGGG - Intronic
1035646567 8:1226615-1226637 CTGAAAAAATAAATGAAATATGG + Intergenic
1035911804 8:3575175-3575197 AAAAAAAAAAAAATGGTGCATGG + Intronic
1035920653 8:3672400-3672422 CAGAAAACATAAACAGTCCAGGG + Intronic
1036134330 8:6145773-6145795 CACAAAAAATTAGTGGGACATGG + Intergenic
1036165455 8:6428768-6428790 CAGAAGAACTAAATATTACAAGG + Intronic
1037167096 8:15844099-15844121 CAGAAAACAAAAATGAAACAAGG - Intergenic
1037500410 8:19480223-19480245 CAGGAAAAATAATAGGTACTAGG - Intronic
1038180067 8:25219247-25219269 CAGAAAAAGAAAACTGTACAAGG - Intronic
1038589541 8:28824151-28824173 AAGAAAAATTTAATAGTACAGGG + Intronic
1038715780 8:29989712-29989734 CACCAAAAATGAACGGTACATGG + Intergenic
1038788424 8:30643811-30643833 AAGAAAAAAAAAAAAGTACATGG + Intronic
1038903623 8:31872303-31872325 CAATAAAAAAAAATGGTAAAAGG - Intronic
1039091771 8:33837398-33837420 CAGAAAAAATAAATGTGACAAGG - Intergenic
1039228476 8:35417057-35417079 CACAAATAATAAATGCTTCAGGG - Intronic
1039393742 8:37204751-37204773 CAGAAAAAATGAAGGGGAGAAGG + Intergenic
1039514920 8:38124649-38124671 CAGAAAGAAAAAATGGCAAAAGG - Intronic
1041340679 8:56842589-56842611 CAGATATAATAAAAGATACAAGG - Intergenic
1041585180 8:59508638-59508660 CATAAGAAATAAATGATAGATGG - Intergenic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1042308287 8:67354195-67354217 CAGAAACAATAAATGGGGAAAGG - Intergenic
1042976152 8:74472052-74472074 CAGAAAAAATATTGGGTACTAGG - Intronic
1043324214 8:79029981-79030003 CAGAAAAAATAAATATAATATGG + Intergenic
1043654440 8:82644351-82644373 GAGTAAAAATAAAGAGTACATGG + Intergenic
1044182555 8:89213844-89213866 CAGGAAAAATACATGATTCATGG - Intergenic
1044548180 8:93482655-93482677 CTGAAAAAATAAAAGTTAGAGGG - Intergenic
1044927290 8:97220415-97220437 GAGGAAAAATAAATTGTACATGG - Intergenic
1045407135 8:101878058-101878080 CAGAAATAACAAATGTTCCACGG + Intronic
1045660669 8:104434292-104434314 CAGAGAGAATAAATTGTAAATGG + Intronic
1045683315 8:104685902-104685924 TAGAAAAAACAAATAGTTCAAGG + Intronic
1045802555 8:106118162-106118184 CAAAAACAAGAAATGGTAAAAGG + Intergenic
1046130724 8:109964871-109964893 CAGGAAAAATAACTGGTGCTAGG + Exonic
1046156164 8:110292874-110292896 CAGAAAAAAAAAATATTTCATGG - Intergenic
1046186251 8:110724386-110724408 CAGAAAAAAAACATAGTAAAAGG + Intergenic
1046551730 8:115726737-115726759 CAGAAAAATTACATGGTTAAAGG - Intronic
1046809833 8:118520898-118520920 CATAAAAAATAATTAGGACAAGG + Intronic
1046951656 8:120025349-120025371 CAGAAAAAAAAAATGGTGGGTGG - Intronic
1047194005 8:122704927-122704949 AAGAAAAATGAAATGGGACAGGG + Intergenic
1047893331 8:129337388-129337410 CATAACAAATAAAAGGTAAAAGG - Intergenic
1048487036 8:134857867-134857889 CATAGAAAATAACTGGTACTGGG - Intergenic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1049026573 8:139995100-139995122 CTCAAAAAATAAATGTTAGAAGG + Intronic
1049132031 8:140854453-140854475 GAGAAAAAATAAACGTTACACGG + Intronic
1049824381 8:144658762-144658784 CAGGAAAAAGAAAAGGTAGAAGG + Intergenic
1050397255 9:5212097-5212119 CAGGAATATAAAATGGTACATGG + Intergenic
1050526118 9:6548217-6548239 AAGAAAATGTAAATGGTCCATGG - Intronic
1051020435 9:12535952-12535974 CAGACAAAATAACTTGTACAGGG + Intergenic
1051301213 9:15653058-15653080 CAGAAAAAGTAAATGGGAAGTGG - Intronic
1051318526 9:15871782-15871804 CGGAAGAAATAAAGGGTAGAAGG - Intronic
1051463361 9:17348984-17349006 CAGAAACAAAAAATGCTTCAAGG - Intronic
1051723710 9:20066629-20066651 CATAAAAAATTTATGGAACATGG + Intergenic
1051795887 9:20869941-20869963 CAGAAAAAATAAAAGCTAAAAGG - Intronic
1052177690 9:25484433-25484455 CACAACAAATATAAGGTACAAGG - Intergenic
1052187822 9:25620286-25620308 AGGAAAAAATTAATGGTTCATGG - Intergenic
1052393547 9:27909813-27909835 CAGGAAAAATAATGGGTACTGGG + Intergenic
1052403222 9:28026802-28026824 AATAAAAAATAAATAGTTCAAGG - Intronic
1052703837 9:31970263-31970285 CAGACTAAATAAATGTTCCAGGG - Intergenic
1052833851 9:33236001-33236023 CAGACAGAATAAATTGTGCAAGG + Intronic
1053068757 9:35088208-35088230 CAGGAATAATGAATGGGACAAGG + Intergenic
1053651497 9:40174485-40174507 CAGAGAAAAAAAAAGTTACATGG + Intergenic
1054192594 9:61996698-61996720 CAAAAAAAAAAAAAAGTACAGGG + Intergenic
1054645811 9:67591993-67592015 CAAAAAAAAAAAAAAGTACAGGG - Intergenic
1054728081 9:68672810-68672832 CAGAGAAAATAACTTGTCCAAGG - Intergenic
1054902001 9:70378834-70378856 CAGAAAAAAAAAAGGCTAGAAGG - Intergenic
1055258234 9:74399251-74399273 CAGATAAAATCAATGGTTCCTGG - Intergenic
1055341022 9:75283320-75283342 CAGAAAAAAAAATGGGTACTAGG - Intergenic
1055390267 9:75813746-75813768 TAGAAAAAAAAAGTGGTCCAGGG - Intergenic
1055880767 9:81000710-81000732 GAGCACAAATAAGTGGTACAAGG - Intergenic
1055956307 9:81776718-81776740 AAGAAAAAATATATAGTCCATGG - Intergenic
1056281719 9:85048003-85048025 CTGAAAAAAAAAAAGGTATAGGG - Intergenic
1056315707 9:85387667-85387689 ATGAAAAAATAATTGGTACCTGG - Intergenic
1056451763 9:86723429-86723451 CAGAACCAATATGTGGTACAGGG + Intergenic
1056487614 9:87074984-87075006 CAAAAAAAAAAAATGGTAGTTGG + Intergenic
1056502311 9:87222000-87222022 CATAGAAAATATATGGTACCTGG - Intergenic
1058170634 9:101676855-101676877 CAGAAAAAAAAAAAGGAAAAGGG - Intronic
1058207754 9:102129667-102129689 CACAATAAAAAAATGGTAAAGGG - Intergenic
1058780520 9:108329573-108329595 AAAAAAGAATAAATGGAACATGG + Intergenic
1058796857 9:108507116-108507138 TAGAAAAAAAAAATGATAAAGGG + Intergenic
1058974111 9:110110223-110110245 CAGAATAAATAAATAGTCCGAGG + Intronic
1059133326 9:111778154-111778176 CAGAATAAATATATTGGACAGGG - Intronic
1059214091 9:112543861-112543883 CAGCAAATATAAATTGGACATGG - Intronic
1059623418 9:116034501-116034523 CATAAAAAATAACAGGTACTAGG + Intergenic
1060844811 9:126827658-126827680 CTAAAAAAATAAATGCCACAAGG - Intronic
1061183358 9:129037698-129037720 CTGAACAAATAAACGCTACAGGG - Intronic
1061611295 9:131748166-131748188 AAGAAAAAAAAAAGCGTACATGG - Intergenic
1185755247 X:2648145-2648167 CAAGAAAAAAAAATGCTACATGG + Intergenic
1186183959 X:7001719-7001741 AATACAAAATAAATGGTACTAGG + Intergenic
1186214265 X:7282164-7282186 CCGATAAAATAAGTGGTAAATGG + Intronic
1186233221 X:7478663-7478685 CAGATAATATAACTGGTTCAAGG - Intergenic
1186656902 X:11622433-11622455 CAGAATAAATCAATTATACATGG + Intronic
1186724376 X:12341334-12341356 AAGAAAAAAAAAATGGTTCAAGG - Intronic
1186842929 X:13503256-13503278 CACAAAGAATAAATGCTTCAGGG - Intergenic
1186973119 X:14871814-14871836 AAAAAAAAAAAAATAGTACATGG - Intronic
1187012759 X:15296991-15297013 CATAAAGAAAACATGGTACAAGG + Intronic
1187744758 X:22396821-22396843 CTGAGAAAATAAAAGGTACTCGG + Intergenic
1187938346 X:24357655-24357677 CACAAATAATTAATGGAACAAGG + Intergenic
1188016482 X:25112638-25112660 AAGAAAAAAAAAATGCTGCATGG - Intergenic
1188263742 X:28044898-28044920 CACAAAGAATAAATGCTTCAGGG - Intergenic
1188287498 X:28345416-28345438 CAGAGGAAATCAATGGCACATGG - Intergenic
1188323241 X:28766510-28766532 CACAAAAAATAAATGCTTGAGGG - Intronic
1188802651 X:34550730-34550752 CAGAATCAATAAATGGTTAAAGG - Intergenic
1188923959 X:36016117-36016139 CACAAAAAATAAATGCTTGATGG - Intergenic
1189451317 X:41134072-41134094 CAGAAAAAAAATATGGTGGAGGG - Intronic
1189688598 X:43591978-43592000 CAGAAAACATAAATGGTGTTTGG + Intergenic
1190556345 X:51639738-51639760 AAGAAAAAAGAAATGTTACAAGG - Intergenic
1190561052 X:51685503-51685525 CAGAAAAAAAAAATGATATTAGG - Intergenic
1190563239 X:51707818-51707840 CAGAAAAAAAAAATGATATTAGG + Intergenic
1191866795 X:65710272-65710294 CACAAAAACTAAAATGTACAAGG - Intronic
1192089224 X:68134972-68134994 CAGAAACAATAAAGGAAACAAGG - Intronic
1192331154 X:70176306-70176328 CAGAAAAAATATATCCAACATGG + Intergenic
1192377379 X:70577270-70577292 CAGAAAAAAAAAATGGCAGATGG + Intronic
1192626801 X:72737249-72737271 TAGAAAAAGTACCTGGTACATGG + Intergenic
1192702005 X:73484407-73484429 CACAATAAAAAAATGATACAGGG + Intergenic
1192886550 X:75341364-75341386 CACAAAAGATAAATGGTTAAGGG - Intergenic
1193047973 X:77072484-77072506 CAAAAAAAAGAAATGGGAAAAGG - Intergenic
1193049176 X:77082994-77083016 CAGGGAAAAGAATTGGTACATGG + Intergenic
1193808519 X:86023018-86023040 CAGAATGAATAAAAGGTAGAAGG - Intronic
1193872152 X:86812941-86812963 CAGCAAAAATGAATGGTCCAGGG - Exonic
1194534690 X:95091849-95091871 CACAAAAAATAAATGCTTGAGGG + Intergenic
1195239417 X:102936404-102936426 CAAAATATATAAATGGTTCATGG - Intergenic
1195281190 X:103334956-103334978 GAAAAAATATAAAAGGTACAAGG + Intergenic
1195848679 X:109257942-109257964 CACAAAAGATAAATGGTTGAGGG - Intergenic
1196116532 X:112005337-112005359 CAGGAAAAATAATGGGTACTAGG + Intronic
1196170063 X:112577608-112577630 CACAAAAAATAAATGCTTGAGGG - Intergenic
1196591741 X:117493470-117493492 CAGAGAAAATTAAAGTTACAGGG + Intergenic
1196699736 X:118655161-118655183 AAGAAAAGTTAAATAGTACAGGG + Intronic
1196699761 X:118655323-118655345 TATAAAAAAAAAATAGTACAGGG + Intronic
1197082206 X:122432762-122432784 CAGAAGAAATAAATAATAAAAGG - Intergenic
1197266736 X:124382200-124382222 CAAAAATAATAAATATTACAAGG - Intronic
1197449133 X:126589483-126589505 CAGAAAAGATAAATGCTTGAGGG - Intergenic
1197540352 X:127752348-127752370 AAGACAAAATAAATGACACATGG + Intergenic
1197760373 X:130023964-130023986 CAGAAGAAAGAAATGGTTCGAGG - Intronic
1197846507 X:130810018-130810040 CAGAAATAAGAAATGATACACGG + Intronic
1197860817 X:130968054-130968076 CAACAAAAACAAATGGTATATGG - Intergenic
1198109046 X:133486738-133486760 CAGAAAAAAAAAATGTGAAAAGG - Intergenic
1198488581 X:137114211-137114233 CAGAAAAACTAAATGGCGAAAGG - Intergenic
1198831582 X:140756767-140756789 CAGAAAAAAAAAATGTTTCTTGG - Intergenic
1198833620 X:140777657-140777679 TAGAAAATATAAATGGTAGTGGG + Intergenic
1199065119 X:143407088-143407110 AAGAAAATATGATTGGTACAAGG - Intergenic
1199218704 X:145291697-145291719 CAGAAAAAATAATTGGTACTAGG + Intergenic
1199364184 X:146959201-146959223 CAGAGAGATTAAATTGTACAAGG - Intergenic
1199587030 X:149425395-149425417 CAAAAAAAAAAAATGCTAAAAGG + Intergenic
1199658886 X:150026435-150026457 TAGAAAATATAAATAGTAAATGG - Intergenic
1199795773 X:151194461-151194483 AAAAAAAAAGAAATGCTACAGGG + Intergenic
1201638688 Y:16154821-16154843 CATAAAATATAAATGTTATATGG + Intergenic
1201668056 Y:16481794-16481816 AAGCAAAAATAAATGTTTCATGG - Intergenic