ID: 943404271

View in Genome Browser
Species Human (GRCh38)
Location 2:187460694-187460716
Sequence AGTTGAATGTAGAAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943404271_943404274 8 Left 943404271 2:187460694-187460716 CCCTCAGACTTCTACATTCAACT No data
Right 943404274 2:187460725-187460747 GCTTCCTTCCATTACTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943404271 Original CRISPR AGTTGAATGTAGAAGTCTGA GGG (reversed) Intergenic
No off target data available for this crispr