ID: 943404711

View in Genome Browser
Species Human (GRCh38)
Location 2:187465793-187465815
Sequence CAATTCCAGTGTCAGATTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943404709_943404711 12 Left 943404709 2:187465758-187465780 CCAAATGAATGAAATGGTTGTTT 0: 1
1: 0
2: 3
3: 28
4: 339
Right 943404711 2:187465793-187465815 CAATTCCAGTGTCAGATTTGAGG 0: 1
1: 0
2: 0
3: 17
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943404711 Original CRISPR CAATTCCAGTGTCAGATTTG AGG Exonic
900706716 1:4085379-4085401 CAATTCCAGTGTCTTATTCTTGG - Intergenic
903695252 1:25201548-25201570 ATATTTCAGTGTGAGATTTGGGG - Intergenic
905931360 1:41790128-41790150 CAATTTCAGCATGAGATTTGGGG - Intronic
906108363 1:43307834-43307856 CAGTGCCAGTGTCAGAATGGTGG + Exonic
910506449 1:87954763-87954785 CTTTTGCAGTGTCAGATTTGTGG + Intergenic
913176560 1:116278045-116278067 CAGTTCCAGTGTCAAATCCGAGG - Intergenic
916383315 1:164237871-164237893 CAATGCCACTGTGAGAGTTGAGG - Intergenic
918949186 1:191113500-191113522 GATTTCCAGTGTCATATATGTGG - Intergenic
922945287 1:229508663-229508685 CGATACCAGTGTCAGCTTTACGG - Intergenic
1064647879 10:17478704-17478726 CAATTCCTGTATCTGATTTTTGG - Intergenic
1065312662 10:24431313-24431335 CAAATTCAGTGTCAGGATTGTGG + Intronic
1065722514 10:28640642-28640664 GATTTCCAGGGTCAGAGTTGGGG + Intergenic
1074221230 10:111440276-111440298 CAATTCCAGACTCACCTTTGTGG + Intergenic
1077348306 11:2075138-2075160 CAAGTCCTCTGTCAGATTTTTGG + Intergenic
1077719866 11:4617181-4617203 CCAATCCAGTGTCGGACTTGGGG - Intergenic
1078696231 11:13635034-13635056 CTATTCTAGTTTCAGATTAGGGG - Intergenic
1080377597 11:31731666-31731688 CATTTCCAGCCCCAGATTTGGGG - Intronic
1082857257 11:57819287-57819309 CAATTGTAGTGTTAGATTAGAGG + Intronic
1085737971 11:79055973-79055995 TAGTTCCAGTGCCAGATGTGTGG - Intronic
1086420094 11:86630341-86630363 CAACTCCAGTGACATATCTGGGG + Intronic
1087047949 11:93859434-93859456 CAAAACCTGTCTCAGATTTGGGG - Intergenic
1087072236 11:94092369-94092391 CAATTCCTGTGACATTTTTGTGG + Intronic
1087141957 11:94773111-94773133 CAAGTCCTTAGTCAGATTTGTGG + Intronic
1088054774 11:105561371-105561393 AATTTCCAGTGTTAGAGTTGAGG - Intergenic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1092053960 12:5493661-5493683 ATATTGCAGTGTCAGATGTGGGG - Intronic
1093712089 12:22339326-22339348 CAAATCCAGAGCCAGAGTTGAGG + Intronic
1094753791 12:33442631-33442653 CAATTCCATTTTCTGAATTGAGG - Intergenic
1102612619 12:114125787-114125809 CAAATCTAGGGTCATATTTGAGG + Intergenic
1104164460 12:126214526-126214548 CAAATCCACTGTCAGCTCTGTGG - Intergenic
1105050608 12:133047124-133047146 CTCTTCCAGTGCCAAATTTGAGG + Intronic
1107662071 13:42648965-42648987 AAATTCCAGTGGCAGAAATGTGG - Intergenic
1108312221 13:49205538-49205560 CATTTCCAATTTCAGATTTTTGG + Intronic
1110301430 13:73933482-73933504 GAATTCCAGTTTCTGATCTGAGG + Intronic
1110384951 13:74899314-74899336 GAATTCCATTATCTGATTTGGGG - Intergenic
1111474819 13:88730289-88730311 CAACTTCCGTGTCAGATATGTGG - Intergenic
1113915439 13:113868348-113868370 CAAGTCCATTATCAGATGTGTGG + Intergenic
1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG + Intergenic
1116116717 14:40661832-40661854 AAATTCCAGTGAAAGATTTTGGG - Intergenic
1116242327 14:42360967-42360989 CAATTCCACTGGCATATTAGGGG + Intergenic
1116740924 14:48753394-48753416 CAAATCCAGTCTCAGAGTTGAGG - Intergenic
1118895128 14:69939516-69939538 CAGTTCCAGTGTCATCTTTATGG + Intronic
1120046561 14:79814089-79814111 CAAGTCCAGTGTATGAGTTGTGG + Intronic
1120390175 14:83896993-83897015 CATTTCCAATTTCAGATTTCTGG - Intergenic
1121771331 14:96544596-96544618 CAGTTTCAGTGTCAGATTTTTGG + Intronic
1122631727 14:103110316-103110338 TAACTGCAGTGTCAGAGTTGGGG - Intronic
1128593342 15:68922474-68922496 CTAGTCCTTTGTCAGATTTGTGG + Intronic
1131909686 15:97184059-97184081 AAATTCCAGTTTGGGATTTGAGG - Intergenic
1134276651 16:12782376-12782398 CAATGCCAGAGCCAGATCTGGGG + Intronic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136677647 16:31926703-31926725 CAATTCCAGTTTTAATTTTGAGG - Intergenic
1137807164 16:51318599-51318621 GAATCACAGTGTCATATTTGAGG + Intergenic
1138891036 16:61144381-61144403 CATTTCCAGTGACCCATTTGTGG - Intergenic
1139128069 16:64106198-64106220 ACATTCCAGCATCAGATTTGGGG - Intergenic
1150544887 17:66145597-66145619 CAATTCCACTGCCATCTTTGTGG + Intronic
1155159875 18:23186770-23186792 CAATTTCAGTGTCTGATTCTAGG + Intronic
1156333753 18:36150303-36150325 CAGTTCCAGTGTCAGTTCTAGGG + Intronic
1162684273 19:12368695-12368717 CAATTCCACTGTTCAATTTGTGG - Intergenic
1163173818 19:15550907-15550929 CTATTGCAGAGTCTGATTTGGGG - Intronic
1164514766 19:28924349-28924371 CATATCCAGTGTCAGAGTTCAGG + Intergenic
1166870474 19:45867362-45867384 CAATTTCACTGTAAGACTTGGGG + Intronic
926294186 2:11556176-11556198 CAAAACCAGTCCCAGATTTGAGG - Intronic
927900137 2:26813021-26813043 CAATCCCTGTCCCAGATTTGAGG + Intergenic
933450115 2:82438353-82438375 CAATTCCATTGACAGTTTTGTGG - Intergenic
933535330 2:83565872-83565894 AATTTCCAGTGTCACGTTTGAGG - Intergenic
934879906 2:97967251-97967273 CAATTACAGTGTAAGATTAAAGG - Intronic
936020724 2:108993079-108993101 CAATTCCATTCTCATATTTTAGG - Intergenic
936841230 2:116771955-116771977 CAATTTCAGTGTAAGTTTTGAGG + Intergenic
940274281 2:151922661-151922683 CATTTCCAGTATCAGATCTTTGG + Intronic
940384411 2:153053518-153053540 CAATTCCAGCATAAAATTTGGGG - Intergenic
940798672 2:158107978-158108000 GAATTCAAATGTTAGATTTGAGG + Intronic
943335038 2:186603008-186603030 AATTTTCAGTGTCAGAATTGTGG + Intronic
943404711 2:187465793-187465815 CAATTCCAGTGTCAGATTTGAGG + Exonic
945024644 2:205608261-205608283 CAATTCCAAGGTCAGACTTTGGG - Intronic
945466687 2:210177688-210177710 CAAGTCCATTGTTAGATATGTGG - Intergenic
946133858 2:217629289-217629311 TTTTTCCAGTGTCAGATTTTGGG - Intronic
946300176 2:218818628-218818650 CATTTCCAGTTTCCAATTTGAGG - Intergenic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
948159578 2:235813070-235813092 CAATGACAGTATGAGATTTGAGG - Intronic
1169514584 20:6301972-6301994 AAGTTCCGGTGACAGATTTGTGG - Intergenic
1173971693 20:47157940-47157962 TAACTCCAGTGTCAGCTTTAGGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175593195 20:60210015-60210037 CACTGCCAGTGTCAGATGTTAGG + Intergenic
1181974804 22:26721358-26721380 CAATTCCAATGTCGTATTTTTGG + Intergenic
951537759 3:23755057-23755079 CATTTCCATGGTCATATTTGTGG + Intergenic
952892179 3:38050688-38050710 AAATTTCAGTATAAGATTTGAGG + Intronic
955608218 3:60729787-60729809 CAATTCCAGTGTTTAATTTCTGG + Intronic
959738931 3:109693743-109693765 GCTTTCCAGTGTCAGATGTGTGG + Intergenic
959834090 3:110897958-110897980 CTATTCTAGTGTCTGATTCGTGG - Intergenic
960252559 3:115472516-115472538 AAATTCAAATTTCAGATTTGGGG + Intergenic
961104154 3:124227098-124227120 CCAGCCCAGTGTGAGATTTGTGG - Intronic
961933207 3:130555199-130555221 CATTTCCAGTGTCGATTTTGGGG + Intergenic
961972789 3:130988332-130988354 CCTTTTCAGTGTCACATTTGTGG - Intronic
963338236 3:144002124-144002146 CAAATCCAGTCTCAGATTCAAGG - Intronic
963874704 3:150462405-150462427 CAATTCCAGTGGCAGATGGGAGG + Exonic
966568106 3:181405939-181405961 CAATTCCTTTGTCAGATATGTGG - Intergenic
967107600 3:186266934-186266956 CAAGTCCAGAGTGAGATGTGAGG + Intronic
971386275 4:26143087-26143109 TAATTTCAGTGTAAGGTTTGAGG - Intergenic
971391044 4:26185460-26185482 TAATTCCAGTTTCAGATGTTTGG - Intronic
973042367 4:45486454-45486476 GAAATGCAGTGTCAGAATTGTGG - Intergenic
974576038 4:63723833-63723855 CAATTAAAATGTCACATTTGTGG + Intergenic
977165917 4:93696684-93696706 CACTTCTAGTTTCAAATTTGAGG - Intronic
979306809 4:119155229-119155251 CATTTCCAGTGTTGGAGTTGGGG - Intronic
980199735 4:129640611-129640633 CATTTCCTGCCTCAGATTTGGGG + Intergenic
981545694 4:145891204-145891226 AAATTCCTGTGTCAGATATTTGG + Intronic
984049629 4:174847998-174848020 CAATGGCAGTTTCAAATTTGTGG + Intronic
984331895 4:178332299-178332321 CCATTTGAGTGTCAGATTTATGG - Intergenic
985705397 5:1397892-1397914 CAATGACAGTGTCTAATTTGTGG + Intronic
991226071 5:64273936-64273958 CAACTCTAGTGTCAAATCTGTGG - Intronic
991902614 5:71475671-71475693 CAATTTCATTGTCAGAATTTAGG - Intronic
992642070 5:78776633-78776655 CAAAGGGAGTGTCAGATTTGTGG - Intergenic
992860900 5:80908695-80908717 AAATTCCAGGCTCAGATTTAAGG + Intergenic
993982215 5:94556868-94556890 CAATTTCAGTGTAAGGTTCGAGG - Intronic
995482585 5:112608000-112608022 CAGTTCCAGTGTCAGTTAGGTGG + Intergenic
998489357 5:142532676-142532698 CACTTTCAATGACAGATTTGGGG - Intergenic
1000180932 5:158810525-158810547 CACAGACAGTGTCAGATTTGAGG - Intronic
1000435098 5:161198326-161198348 TAATGCCAGTTTCAGATTTATGG + Intergenic
1001609218 5:172986639-172986661 CAAGTCCAGTGTCAGAGTCTGGG + Intronic
1002202857 5:177540442-177540464 CAAGCCCAGTGTCAGAGTGGGGG - Intronic
1006165442 6:32061910-32061932 AAATTCCAGGGTCAGCTGTGGGG + Intronic
1007843833 6:44738204-44738226 AAATGCTAGTGTCAGATTCGAGG - Intergenic
1008893434 6:56523171-56523193 CAAATCTAGAGTCAGATTTGGGG + Intronic
1010162083 6:72868494-72868516 CACTGCCAGTGCCAGAATTGAGG - Intronic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1011499392 6:87971161-87971183 TAATTCAAGTGTGAGTTTTGAGG + Intergenic
1012103032 6:95115712-95115734 AAATTCCATTTTCACATTTGTGG - Intergenic
1012488195 6:99745551-99745573 CAATTCAAGAGTCAGAATGGTGG + Intergenic
1013142171 6:107348078-107348100 AAATTCCATTGTCTTATTTGGGG - Intronic
1014573116 6:123036066-123036088 CAATTCCATTGTAAAATTTGAGG + Intronic
1014900526 6:126958423-126958445 CAATTCCAATCTTTGATTTGGGG + Intergenic
1016836607 6:148483415-148483437 CAATTTCAGTATAAGGTTTGGGG + Intronic
1017547333 6:155466660-155466682 CTACTCCAGTGGCAGAGTTGGGG - Intergenic
1018051789 6:160015714-160015736 CAAATTCAATGTGAGATTTGGGG - Intronic
1018223901 6:161609151-161609173 CACTTGCAGTGTCAGAATTATGG - Intronic
1019033587 6:169034777-169034799 CTATGCCAGTGTCAGCTTTAAGG + Intergenic
1020404522 7:7816901-7816923 CAACTACATGGTCAGATTTGTGG - Intronic
1021807479 7:24371611-24371633 CTAATCCAGTGTCAGCTGTGTGG - Intergenic
1023659737 7:42459591-42459613 CAAGTCAAGTCTCAGTTTTGAGG + Intergenic
1031001574 7:116421626-116421648 CAATTCCAATGTCTCATTTTAGG + Intronic
1031536718 7:122942875-122942897 CAAGTCCAGTTTCAGATAGGAGG + Intergenic
1032000618 7:128262822-128262844 CAAGCCCAGTGTCAGTGTTGTGG - Intergenic
1033599509 7:142878471-142878493 GAATTCCTGTCTCATATTTGTGG + Intronic
1033836028 7:145313137-145313159 CAAGACCACTCTCAGATTTGAGG - Intergenic
1037148046 8:15597718-15597740 TAATTCCAGTGTCAGATATCTGG - Intronic
1039437100 8:37567187-37567209 CAGAACCAGGGTCAGATTTGGGG - Intergenic
1041967337 8:63694481-63694503 CCATTCCAGTGCCTCATTTGGGG - Intergenic
1043222258 8:77681745-77681767 CAACTCCAGTGCCAGATTTTTGG + Intergenic
1044061429 8:87641208-87641230 AAATTCCAGTGGCATTTTTGGGG - Intergenic
1044191803 8:89327693-89327715 TAATACCAGTGTCACATTTTTGG + Intergenic
1045490460 8:102664580-102664602 CTGTTCCAGTGTCAGAATTCTGG + Intergenic
1046323975 8:112616169-112616191 TAATTACAGTGCCAAATTTGTGG + Intronic
1046608736 8:116400852-116400874 GAATTCCACTGTCTTATTTGTGG - Intergenic
1047563922 8:126020269-126020291 CAAAACCAGTGTCAACTTTGAGG + Intergenic
1048839648 8:138553763-138553785 CAGATCCAGTGCCAGAATTGAGG - Intergenic
1050245724 9:3688055-3688077 CAATTTCAGTTTCACATTTTAGG - Intergenic
1051589776 9:18765905-18765927 CAATTCCATTCTCAGCTGTGTGG - Intronic
1052064638 9:24002653-24002675 TAATTTCAGTTTCAGTTTTGGGG - Intergenic
1052668384 9:31523318-31523340 GAGTTACATTGTCAGATTTGAGG + Intergenic
1052720839 9:32169246-32169268 CAACTCCAATGTCACATTTCTGG + Intergenic
1052845085 9:33328459-33328481 CAACTCCAGAATCAGAGTTGAGG - Intronic
1055292459 9:74796846-74796868 AAATTCCAGTGTCAAAATGGTGG + Exonic
1058644839 9:107121366-107121388 CAATACCAGTATCACATTTTGGG - Intergenic
1058980833 9:110168727-110168749 CAATCCCAGTGTCTGGTTTGGGG + Exonic
1060779346 9:126400127-126400149 CAAATCCAGTGTCAAGTTTGAGG + Intronic
1188843858 X:35049511-35049533 TAATCCCAGAGTCAGTTTTGGGG + Intergenic
1190010717 X:46782302-46782324 CATGACCAGAGTCAGATTTGTGG - Intergenic
1190968657 X:55327968-55327990 CACTTCCAGTCTCAGGTTAGTGG - Intergenic
1192268491 X:69556591-69556613 GAATTCCAGTGTCATGTTTGAGG - Intergenic
1192960346 X:76123937-76123959 GACTTCCTGTGGCAGATTTGGGG + Intergenic
1193753865 X:85382236-85382258 CATTTACAATGACAGATTTGGGG + Intergenic
1194003528 X:88461991-88462013 AAATTCCTGTGTCAAATTTCAGG + Intergenic
1197998363 X:132405336-132405358 CTATTCCAGTGTCTGATTCAGGG - Intronic
1199820167 X:151437382-151437404 CAAGTCCTTTGTCAGATATGTGG + Intergenic
1199971126 X:152862613-152862635 CAGTGCCAGTGTCATCTTTGAGG + Exonic
1200255204 X:154577820-154577842 CAAATCTAGTGTCTGATTTGAGG + Intergenic
1200262565 X:154626584-154626606 CAAATCTAGTGTCTGATTTGAGG - Intergenic
1200616150 Y:5381975-5381997 GTATTCCAGTGACAGATTTTTGG - Intronic
1201930878 Y:19345571-19345593 CATAGCCAGTGTCAGGTTTGTGG + Intergenic