ID: 943427307

View in Genome Browser
Species Human (GRCh38)
Location 2:187752487-187752509
Sequence GGTCACACTAATGCAAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943427301_943427307 2 Left 943427301 2:187752462-187752484 CCTTTGACTCCAGGTCTCACATC 0: 229
1: 1563
2: 1911
3: 1372
4: 1007
Right 943427307 2:187752487-187752509 GGTCACACTAATGCAAAGGTGGG No data
943427303_943427307 -7 Left 943427303 2:187752471-187752493 CCAGGTCTCACATCCAGGTCACA 0: 82
1: 526
2: 1064
3: 1591
4: 1597
Right 943427307 2:187752487-187752509 GGTCACACTAATGCAAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943427307 Original CRISPR GGTCACACTAATGCAAAGGT GGG Intergenic
No off target data available for this crispr