ID: 943430201

View in Genome Browser
Species Human (GRCh38)
Location 2:187790153-187790175
Sequence GGAGAACTGCTTAAGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943430197_943430201 10 Left 943430197 2:187790120-187790142 CCTGTAATCTCAGCTACTCAGGA 0: 3587
1: 62991
2: 151514
3: 233690
4: 199225
Right 943430201 2:187790153-187790175 GGAGAACTGCTTAAGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943430201 Original CRISPR GGAGAACTGCTTAAGCCAGG AGG Intergenic
No off target data available for this crispr