ID: 943436950

View in Genome Browser
Species Human (GRCh38)
Location 2:187876664-187876686
Sequence TGTCAAAAGCTGAAAGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943436946_943436950 20 Left 943436946 2:187876621-187876643 CCGTGTAACAGCTCACAAACTTC No data
Right 943436950 2:187876664-187876686 TGTCAAAAGCTGAAAGGTGGTGG No data
943436947_943436950 -2 Left 943436947 2:187876643-187876665 CCTGAAAATTTAACAATCAGTTG No data
Right 943436950 2:187876664-187876686 TGTCAAAAGCTGAAAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943436950 Original CRISPR TGTCAAAAGCTGAAAGGTGG TGG Intergenic
No off target data available for this crispr