ID: 943442171

View in Genome Browser
Species Human (GRCh38)
Location 2:187938691-187938713
Sequence TGGATTTTTCTAGTTTAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943442171_943442173 22 Left 943442171 2:187938691-187938713 CCTATCTAAACTAGAAAAATCCA No data
Right 943442173 2:187938736-187938758 GAATACATGTATGTGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943442171 Original CRISPR TGGATTTTTCTAGTTTAGAT AGG (reversed) Intergenic
No off target data available for this crispr