ID: 943446561

View in Genome Browser
Species Human (GRCh38)
Location 2:187994449-187994471
Sequence CACCGTGCTTCAGGGGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943446557_943446561 -4 Left 943446557 2:187994430-187994452 CCACAGTGAGGGATCTGGGCACC No data
Right 943446561 2:187994449-187994471 CACCGTGCTTCAGGGGCATAAGG No data
943446552_943446561 29 Left 943446552 2:187994397-187994419 CCAAGGAGCAAGTGTGAAGTGTG No data
Right 943446561 2:187994449-187994471 CACCGTGCTTCAGGGGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943446561 Original CRISPR CACCGTGCTTCAGGGGCATA AGG Intergenic
No off target data available for this crispr