ID: 943448416

View in Genome Browser
Species Human (GRCh38)
Location 2:188018742-188018764
Sequence GACTCACGTTTCCATATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943448416_943448418 16 Left 943448416 2:188018742-188018764 CCAGTCATATGGAAACGTGAGTC No data
Right 943448418 2:188018781-188018803 TTTATAAATTACTCAGTCTCAGG 0: 595
1: 7833
2: 14234
3: 14035
4: 10575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943448416 Original CRISPR GACTCACGTTTCCATATGAC TGG (reversed) Intergenic
No off target data available for this crispr