ID: 943449961

View in Genome Browser
Species Human (GRCh38)
Location 2:188034365-188034387
Sequence GCGGCAAATGCCGCTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943449952_943449961 13 Left 943449952 2:188034329-188034351 CCACGCGGGGACGCCTGCCTTGG No data
Right 943449961 2:188034365-188034387 GCGGCAAATGCCGCTTTTCTGGG No data
943449954_943449961 0 Left 943449954 2:188034342-188034364 CCTGCCTTGGTCCTTCACCCTTA 0: 465
1: 199
2: 49
3: 107
4: 236
Right 943449961 2:188034365-188034387 GCGGCAAATGCCGCTTTTCTGGG No data
943449955_943449961 -4 Left 943449955 2:188034346-188034368 CCTTGGTCCTTCACCCTTAGCGG 0: 269
1: 300
2: 309
3: 399
4: 245
Right 943449961 2:188034365-188034387 GCGGCAAATGCCGCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943449961 Original CRISPR GCGGCAAATGCCGCTTTTCT GGG Intergenic
No off target data available for this crispr