ID: 943453186

View in Genome Browser
Species Human (GRCh38)
Location 2:188071811-188071833
Sequence ACCTTAGGACAGAGACTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943453181_943453186 15 Left 943453181 2:188071773-188071795 CCCTTACATTTTACTAAAGTTGT No data
Right 943453186 2:188071811-188071833 ACCTTAGGACAGAGACTATGGGG No data
943453182_943453186 14 Left 943453182 2:188071774-188071796 CCTTACATTTTACTAAAGTTGTT No data
Right 943453186 2:188071811-188071833 ACCTTAGGACAGAGACTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943453186 Original CRISPR ACCTTAGGACAGAGACTATG GGG Intergenic
No off target data available for this crispr