ID: 943456781

View in Genome Browser
Species Human (GRCh38)
Location 2:188118304-188118326
Sequence TGGGAAGTCCTGTGAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943456781_943456789 18 Left 943456781 2:188118304-188118326 CCAGTTTTTCACAGGACTTCCCA No data
Right 943456789 2:188118345-188118367 TAAATGAGGCTTGGAGAGGAGGG No data
943456781_943456786 9 Left 943456781 2:188118304-188118326 CCAGTTTTTCACAGGACTTCCCA No data
Right 943456786 2:188118336-188118358 CAATACTTTTAAATGAGGCTTGG No data
943456781_943456784 4 Left 943456781 2:188118304-188118326 CCAGTTTTTCACAGGACTTCCCA No data
Right 943456784 2:188118331-188118353 TACTCCAATACTTTTAAATGAGG No data
943456781_943456788 17 Left 943456781 2:188118304-188118326 CCAGTTTTTCACAGGACTTCCCA No data
Right 943456788 2:188118344-188118366 TTAAATGAGGCTTGGAGAGGAGG No data
943456781_943456787 14 Left 943456781 2:188118304-188118326 CCAGTTTTTCACAGGACTTCCCA No data
Right 943456787 2:188118341-188118363 CTTTTAAATGAGGCTTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943456781 Original CRISPR TGGGAAGTCCTGTGAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr