ID: 943456972

View in Genome Browser
Species Human (GRCh38)
Location 2:188120423-188120445
Sequence GGAATGGCGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943456972_943456980 4 Left 943456972 2:188120423-188120445 CCCCCTGGGGTTCACGCCATTCC No data
Right 943456980 2:188120450-188120472 CCTCAGCCTCCCGAATAGCTAGG 0: 3351
1: 113068
2: 299072
3: 329859
4: 341738
943456972_943456982 12 Left 943456972 2:188120423-188120445 CCCCCTGGGGTTCACGCCATTCC No data
Right 943456982 2:188120458-188120480 TCCCGAATAGCTAGGACTACAGG 0: 57
1: 3513
2: 72066
3: 204765
4: 316463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943456972 Original CRISPR GGAATGGCGTGAACCCCAGG GGG (reversed) Intergenic
No off target data available for this crispr