ID: 943456972 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:188120423-188120445 |
Sequence | GGAATGGCGTGAACCCCAGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
943456972_943456980 | 4 | Left | 943456972 | 2:188120423-188120445 | CCCCCTGGGGTTCACGCCATTCC | No data | ||
Right | 943456980 | 2:188120450-188120472 | CCTCAGCCTCCCGAATAGCTAGG | 0: 3351 1: 113068 2: 299072 3: 329859 4: 341738 |
||||
943456972_943456982 | 12 | Left | 943456972 | 2:188120423-188120445 | CCCCCTGGGGTTCACGCCATTCC | No data | ||
Right | 943456982 | 2:188120458-188120480 | TCCCGAATAGCTAGGACTACAGG | 0: 57 1: 3513 2: 72066 3: 204765 4: 316463 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
943456972 | Original CRISPR | GGAATGGCGTGAACCCCAGG GGG (reversed) | Intergenic | ||
No off target data available for this crispr |