ID: 943462408

View in Genome Browser
Species Human (GRCh38)
Location 2:188184923-188184945
Sequence ACACCAATTAAGTTAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943462408_943462413 29 Left 943462408 2:188184923-188184945 CCTGTTTTTAACTTAATTGGTGT No data
Right 943462413 2:188184975-188184997 AAGCCCTGTGTTGTGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943462408 Original CRISPR ACACCAATTAAGTTAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr