ID: 943464958

View in Genome Browser
Species Human (GRCh38)
Location 2:188217867-188217889
Sequence AAGAAAAGGGAGCAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943464958_943464968 13 Left 943464958 2:188217867-188217889 CCAGCCTCCTGCTCCCTTTTCTT No data
Right 943464968 2:188217903-188217925 GCAGGTGTCATGGCACAGCCAGG No data
943464958_943464965 3 Left 943464958 2:188217867-188217889 CCAGCCTCCTGCTCCCTTTTCTT No data
Right 943464965 2:188217893-188217915 CCCCACATGTGCAGGTGTCATGG No data
943464958_943464963 -5 Left 943464958 2:188217867-188217889 CCAGCCTCCTGCTCCCTTTTCTT No data
Right 943464963 2:188217885-188217907 TTCTTTGTCCCCACATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943464958 Original CRISPR AAGAAAAGGGAGCAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr