ID: 943466086

View in Genome Browser
Species Human (GRCh38)
Location 2:188230857-188230879
Sequence CCTCTAGTACTGCTGGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943466086_943466096 28 Left 943466086 2:188230857-188230879 CCCTAACCCAGCAGTACTAGAGG No data
Right 943466096 2:188230908-188230930 AGGTGTGGAGTGGGAAATTAGGG No data
943466086_943466095 27 Left 943466086 2:188230857-188230879 CCCTAACCCAGCAGTACTAGAGG No data
Right 943466095 2:188230907-188230929 GAGGTGTGGAGTGGGAAATTAGG No data
943466086_943466093 18 Left 943466086 2:188230857-188230879 CCCTAACCCAGCAGTACTAGAGG No data
Right 943466093 2:188230898-188230920 AGAAATATAGAGGTGTGGAGTGG 0: 66
1: 326
2: 227
3: 83
4: 516
943466086_943466092 13 Left 943466086 2:188230857-188230879 CCCTAACCCAGCAGTACTAGAGG No data
Right 943466092 2:188230893-188230915 CACACAGAAATATAGAGGTGTGG 0: 64
1: 48
2: 20
3: 31
4: 292
943466086_943466094 19 Left 943466086 2:188230857-188230879 CCCTAACCCAGCAGTACTAGAGG No data
Right 943466094 2:188230899-188230921 GAAATATAGAGGTGTGGAGTGGG 0: 66
1: 339
2: 219
3: 75
4: 275
943466086_943466097 29 Left 943466086 2:188230857-188230879 CCCTAACCCAGCAGTACTAGAGG No data
Right 943466097 2:188230909-188230931 GGTGTGGAGTGGGAAATTAGGGG No data
943466086_943466091 8 Left 943466086 2:188230857-188230879 CCCTAACCCAGCAGTACTAGAGG No data
Right 943466091 2:188230888-188230910 ATACACACACAGAAATATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943466086 Original CRISPR CCTCTAGTACTGCTGGGTTA GGG (reversed) Intergenic
No off target data available for this crispr