ID: 943466549

View in Genome Browser
Species Human (GRCh38)
Location 2:188235837-188235859
Sequence ACAGAGGGACTTTACTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943466549_943466558 26 Left 943466549 2:188235837-188235859 CCCTCTCAGTAAAGTCCCTCTGT No data
Right 943466558 2:188235886-188235908 ACGTTAACTGCTATTCTCTTTGG No data
943466549_943466557 3 Left 943466549 2:188235837-188235859 CCCTCTCAGTAAAGTCCCTCTGT No data
Right 943466557 2:188235863-188235885 AAGAATGGGTTTGGCACTCTGGG No data
943466549_943466556 2 Left 943466549 2:188235837-188235859 CCCTCTCAGTAAAGTCCCTCTGT No data
Right 943466556 2:188235862-188235884 TAAGAATGGGTTTGGCACTCTGG No data
943466549_943466555 -6 Left 943466549 2:188235837-188235859 CCCTCTCAGTAAAGTCCCTCTGT No data
Right 943466555 2:188235854-188235876 CTCTGTGCTAAGAATGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943466549 Original CRISPR ACAGAGGGACTTTACTGAGA GGG (reversed) Intergenic
No off target data available for this crispr