ID: 943469050

View in Genome Browser
Species Human (GRCh38)
Location 2:188269705-188269727
Sequence AACCGTAGCCTCTACTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943469048_943469050 14 Left 943469048 2:188269668-188269690 CCACTTTAGAAGATAGGCTATAT No data
Right 943469050 2:188269705-188269727 AACCGTAGCCTCTACTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943469050 Original CRISPR AACCGTAGCCTCTACTACAA AGG Intergenic