ID: 943470594

View in Genome Browser
Species Human (GRCh38)
Location 2:188290493-188290515
Sequence CCTCCAAACCATGAGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943470590_943470594 19 Left 943470590 2:188290451-188290473 CCAAGTTATTATGAGGACTGATT 0: 1
1: 0
2: 0
3: 17
4: 139
Right 943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 177
943470588_943470594 24 Left 943470588 2:188290446-188290468 CCCAGCCAAGTTATTATGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 105
Right 943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 177
943470589_943470594 23 Left 943470589 2:188290447-188290469 CCAGCCAAGTTATTATGAGGACT 0: 1
1: 0
2: 0
3: 10
4: 100
Right 943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 177
943470587_943470594 25 Left 943470587 2:188290445-188290467 CCCCAGCCAAGTTATTATGAGGA 0: 1
1: 0
2: 2
3: 6
4: 145
Right 943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG 0: 1
1: 0
2: 1
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943470594 Original CRISPR CCTCCAAACCATGAGATTTG GGG Intergenic
902177610 1:14662534-14662556 CCTCCAAACCATGAGTATTTTGG + Intronic
903717517 1:25379344-25379366 TCTCCAACACATGAAATTTGAGG + Intronic
904678244 1:32211721-32211743 CCTCCAAATCAGGAGAGTTGGGG - Intronic
905536243 1:38724172-38724194 CCTTAAACCCATGAGATCTGAGG - Intergenic
909047301 1:70726433-70726455 CCTACAAACTAGAAGATTTGGGG - Intergenic
910883178 1:91940835-91940857 CCCCTAAACCATGGGGTTTGGGG + Intergenic
913385645 1:118255656-118255678 CTTCCACACCATGACATCTGAGG - Intergenic
913479831 1:119277427-119277449 CCCCCAGACCATGACATCTGTGG - Intergenic
913717749 1:121555075-121555097 CTTCCAAAGCCTGAGATTTCAGG - Intergenic
915841933 1:159220293-159220315 CCTCCTAACCATTATATTGGGGG + Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
921627090 1:217388724-217388746 CCTCCAAAGCCAGTGATTTGTGG + Intergenic
923969971 1:239189408-239189430 CCTCCAAATTCTGAGATTTGAGG + Intergenic
1062985591 10:1765805-1765827 TCTCCAACACATGAAATTTGGGG - Intergenic
1067928233 10:50532725-50532747 CTTCCAAATCATGAATTTTGCGG - Intronic
1068917324 10:62446323-62446345 CTTCCTAACCATGTGACTTGGGG + Intronic
1072408404 10:95176594-95176616 CCTCCAAAGCAAGAAACTTGAGG - Intergenic
1072937914 10:99731230-99731252 CCACTAAACTATGAGCTTTGGGG + Intronic
1073201657 10:101740494-101740516 CCTCCCAACCAAGAGCCTTGGGG - Intergenic
1074495503 10:113976816-113976838 CCTACACATCATGAGATTTTTGG - Intergenic
1074738231 10:116458483-116458505 CCTCCAATCAATAAGATCTGAGG + Intronic
1075548254 10:123372587-123372609 CCTACAAAACCTCAGATTTGGGG - Intergenic
1076976939 11:180092-180114 AGTCCAAACAGTGAGATTTGGGG + Intronic
1077548936 11:3190874-3190896 CTTCCAACACATGAGCTTTGGGG + Intergenic
1078871437 11:15348832-15348854 TCTCCAAACCAGGGAATTTGCGG - Intergenic
1079153097 11:17919344-17919366 CCTCCTAGCCATTAGATCTGAGG - Intronic
1079545740 11:21629953-21629975 TCTCCAAACCCTGCCATTTGGGG + Intergenic
1080040428 11:27754173-27754195 CCCCCACACCGTGAGAGTTGAGG + Intergenic
1083782355 11:64925037-64925059 CCCCCACCCCATGAGGTTTGGGG + Intronic
1084038662 11:66529239-66529261 CCTGCAAACGGTGAGATGTGAGG + Intronic
1084162299 11:67356473-67356495 CCACCTCACCATGAGGTTTGTGG + Intronic
1084287642 11:68142354-68142376 CCTCCCAACTGTGTGATTTGGGG - Intergenic
1084744788 11:71162456-71162478 CTTCCAACACATGAAATTTGAGG + Intronic
1086999140 11:93395317-93395339 TCTCAAAACCTTTAGATTTGGGG - Intronic
1088526400 11:110760883-110760905 GCTGCAAACCATCAGATTGGAGG - Intergenic
1093763796 12:22939499-22939521 TCTGCAACCCATGAAATTTGGGG - Intergenic
1094057271 12:26280025-26280047 CCTCCAAAGCATGAGACACGGGG + Intronic
1098229405 12:68357722-68357744 CTTCCAAACCATGTGATCTTGGG + Intergenic
1099023622 12:77437857-77437879 CCTCCAACGTATGAGATTTTTGG - Intergenic
1100549509 12:95634134-95634156 CCTCCTAGCCAGGAGTTTTGAGG - Intergenic
1102332662 12:112048007-112048029 CCTACAAATCAAGAGATTTCAGG - Intronic
1104138342 12:125961953-125961975 CCTACAACACATGAGAATTGTGG - Intergenic
1104789454 12:131472738-131472760 ATTGCAAACCATGAGCTTTGTGG + Intergenic
1108265552 13:48704264-48704286 CCTTCAAACCGTGAGATTATAGG - Intronic
1108275519 13:48805578-48805600 CCTGAAAACCAGGAAATTTGAGG + Intergenic
1112332503 13:98487232-98487254 CTTCCAAACCATGACTTCTGAGG + Intronic
1117494923 14:56293641-56293663 CCTCCAGACCATGCAATTAGAGG - Intronic
1118405108 14:65414146-65414168 CCGCAAAACCTTGAAATTTGGGG - Intronic
1118763497 14:68894981-68895003 CCACCAAATCATGTGCTTTGTGG + Intronic
1124117186 15:26856277-26856299 CCTACAAATCATAAGAATTGTGG - Intronic
1125658544 15:41378059-41378081 ACTCCAAATCAGCAGATTTGGGG + Intronic
1126769015 15:52036620-52036642 CTTCCAACCCATGAACTTTGGGG + Intronic
1128175015 15:65547510-65547532 CCTACAAACAATGTGATTTATGG - Intronic
1128475150 15:67991157-67991179 CCTGCTAATCATGAGATTGGAGG - Intergenic
1130143546 15:81253926-81253948 CCTCCATATCAGGAGATCTGTGG + Intronic
1131863110 15:96675739-96675761 CCTTCAAAGCCTGAGAGTTGTGG + Intergenic
1132048698 15:98588848-98588870 CCTCCAAACCACAAAATCTGAGG + Intergenic
1134492740 16:14707856-14707878 CCTCCAAAGCAAGAAACTTGAGG + Intergenic
1134498121 16:14746978-14747000 CCTCCAAAGCAAGAAACTTGAGG + Intronic
1134582452 16:15382115-15382137 CCTCCAAAGCAAGAAACTTGAGG - Intergenic
1135222592 16:20625574-20625596 ACTCCAAAGCAGGAGATCTGGGG - Intronic
1135913520 16:26582556-26582578 TCTTCCAACCATAAGATTTGGGG + Intergenic
1136351434 16:29711043-29711065 CCTCCAAGCCATGACATCAGAGG - Intergenic
1137384142 16:48025871-48025893 CCTCCACTCCATGAGCTCTGGGG - Intergenic
1137572144 16:49573697-49573719 TCTCCAACACATGAAATTTGGGG + Intronic
1142443321 16:90116578-90116600 ACTCCAAATAGTGAGATTTGGGG - Intergenic
1142464077 17:118266-118288 AGTCCAAACAGTGAGATTTGGGG + Intergenic
1143947176 17:10603672-10603694 GCTCCAAACCTTAATATTTGTGG + Intergenic
1145183385 17:20772802-20772824 CATCCAGACAATGAGATTCGGGG + Intergenic
1146009484 17:29181751-29181773 CTTCAAAAACATGACATTTGAGG + Intergenic
1146138846 17:30347291-30347313 CCTCCAAACCCTGTCCTTTGGGG - Intergenic
1149088081 17:52743753-52743775 CCTCAGAATTATGAGATTTGAGG - Intergenic
1152112475 17:78365002-78365024 CTTCCCATCCATGAGATTTGGGG - Intergenic
1153372266 18:4332678-4332700 CCTCCAACCCAGGCCATTTGAGG - Intronic
1153572331 18:6485892-6485914 CCTACAAACAATGAAATTTAAGG + Intergenic
1153764700 18:8364493-8364515 CCTCTAAACCAAAAGGTTTGGGG + Intronic
1157154703 18:45254562-45254584 CCTTCAAAGCATGAAAATTGAGG - Intronic
1158817022 18:61113469-61113491 CCTCCATATCCTGAGATTTGGGG - Intergenic
1159622205 18:70651431-70651453 CCTCCTTCCCTTGAGATTTGGGG + Intergenic
1159660162 18:71085995-71086017 CTTCCAAACCATAAGGTTTCAGG - Intergenic
1159873027 18:73779581-73779603 CCTCCAAAACAAGAAATTTGTGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
926057002 2:9779535-9779557 GCTTAAAACCATGAAATTTGTGG + Intergenic
926401258 2:12499446-12499468 ACTCAAAACCATTAGATTTAGGG + Intergenic
928024850 2:27730827-27730849 CAGCCAAACCCTGAGACTTGGGG - Intergenic
932386929 2:71343631-71343653 TCTCCTAACCATGTGAATTGAGG + Intronic
935469672 2:103443335-103443357 CCTAGGAACCCTGAGATTTGAGG + Intergenic
935775733 2:106469436-106469458 CCTTCAAACCAGCACATTTGCGG - Intergenic
937244001 2:120480628-120480650 TTTCCTGACCATGAGATTTGGGG - Intergenic
939047579 2:137267974-137267996 GCTTCAAACCATGATATTGGGGG + Intronic
939577950 2:143918487-143918509 CCCACAAAACATGAGAATTGTGG - Intergenic
940984699 2:160041019-160041041 CCTCCCAACAATGAAATTTTGGG - Intronic
943344482 2:186722240-186722262 CATCAAAAGCCTGAGATTTGGGG - Intronic
943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG + Intergenic
946309681 2:218876450-218876472 CCTCCCCACCATGAGCCTTGAGG - Intergenic
946347522 2:219123053-219123075 TCTCCAAAGCTTGAGAATTGGGG - Intronic
947064358 2:226204824-226204846 CCTACAATCCTTGGGATTTGGGG + Intergenic
947568109 2:231208748-231208770 CCTTCTAACCCTGAGAGTTGAGG - Intronic
947782229 2:232778681-232778703 CCCACAAAACATGAGACTTGAGG + Intronic
948406079 2:237720592-237720614 CCTCCACAGCATGGGCTTTGTGG - Intronic
1169664739 20:8021311-8021333 CTTCCTAGCCATGTGATTTGGGG + Intergenic
1170101608 20:12706823-12706845 CTTCCAAGCCATTAAATTTGTGG + Intergenic
1170528500 20:17265679-17265701 CTTACAAACCATGAGAATTTGGG - Intronic
1170778039 20:19395955-19395977 CCTCCAAACCCTGAGATGGTTGG + Intronic
1172606625 20:36218523-36218545 CCTTCAAGCCATGTGACTTGGGG - Intronic
1173988716 20:47283153-47283175 CCTCCAAAACATGATTCTTGGGG - Intronic
1174320628 20:49739112-49739134 ACTCCAATCCATGAGAACTGTGG - Intergenic
1177613439 21:23485365-23485387 CCTAATAATCATGAGATTTGTGG - Intergenic
1178790045 21:35691446-35691468 CATCCAGACAATGAGATGTGGGG + Intronic
1180604421 22:17046272-17046294 TCTCCAAAGCAGGAGATTTGAGG + Intergenic
1183253386 22:36745604-36745626 CTTCCCATCCATGTGATTTGAGG + Intergenic
949940511 3:9150858-9150880 CCTCCATAGCATGTGATCTGGGG - Intronic
950851632 3:16067676-16067698 CCTTCAAAACAAGAAATTTGGGG + Intergenic
951990742 3:28673720-28673742 CATCCAGAACACGAGATTTGTGG - Intergenic
953472354 3:43178045-43178067 CCTCCAAATCATCAGACTTAGGG - Intergenic
955514130 3:59709838-59709860 CCTCCAGACCATGCCATCTGAGG - Intergenic
955791768 3:62595430-62595452 CTTGCAAACTATGAAATTTGGGG + Intronic
956327678 3:68071386-68071408 CCTCCCAAACATGAGAATTGTGG + Intronic
957676002 3:83365389-83365411 GCTTTAAACCATCAGATTTGTGG + Intergenic
959675314 3:109028630-109028652 CTTCCAAACCATATGCTTTGAGG - Intronic
961723723 3:128912260-128912282 GCTCCACCCCATGAGATCTGGGG + Intronic
966172828 3:177101414-177101436 TCTCCAACACATGAAATTTGAGG - Intronic
967724009 3:192844672-192844694 CCTCCAGCCCATCAGAATTGGGG - Intronic
968363637 3:198167966-198167988 ACTCCAAACAGTGAGATTTGGGG - Intergenic
969697553 4:8743527-8743549 CCTACAACACATGGGATTTGTGG - Intergenic
970031692 4:11683422-11683444 CCTCCTTTCCATGAGATCTGTGG + Intergenic
973080157 4:45980703-45980725 TCTACAAACAATGAGATCTGGGG + Intergenic
974096918 4:57373953-57373975 TCTCCAAACCCTGTGATTTAGGG + Intergenic
976842287 4:89445586-89445608 CCTGCAAAGTATGAGAGTTGAGG - Intergenic
978044804 4:104113315-104113337 TCTCCAAAACATCAGATTTTTGG - Intergenic
978377006 4:108084906-108084928 CTTACAGACCGTGAGATTTGGGG - Intronic
979602346 4:122600218-122600240 TCTCCAATCCATGAGATGTAGGG - Intergenic
979739612 4:124132838-124132860 CCTCCAGCCCAAGAGATGTGGGG - Intergenic
981082984 4:140653610-140653632 CCTCCTAACCATTAAATTGGTGG - Intronic
983475829 4:168210760-168210782 TTTCCAAAACATGAAATTTGGGG - Intergenic
985054825 4:186027091-186027113 CATCCAAACCATATCATTTGAGG - Intergenic
987272156 5:16321956-16321978 CTTCCAAGTGATGAGATTTGAGG + Intergenic
988762941 5:34333876-34333898 CATCCACAGCATGAGATTTAAGG + Intergenic
989137033 5:38166211-38166233 CTTCCAAATCCTGACATTTGAGG + Intergenic
989321111 5:40134770-40134792 CCAACAAACTGTGAGATTTGGGG + Intergenic
993352954 5:86872520-86872542 CTTCCAAACCATGTGCTTTATGG - Intergenic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
996050980 5:118933047-118933069 CCTCCTAACTATGAAATTTGTGG - Intronic
997272992 5:132557214-132557236 CCTCCTGACCCTGAGATTCGCGG + Exonic
997314009 5:132916635-132916657 CCTCCAAACGAAGAGATGAGAGG - Intronic
1000091095 5:157930286-157930308 TTTCCAAAACATGAGCTTTGAGG + Intergenic
1000263609 5:159613943-159613965 GCTCCAAAACATGACTTTTGTGG - Intergenic
1001873855 5:175182283-175182305 CCTCCAAAACATCACATTTCCGG - Intergenic
1012314830 6:97773269-97773291 CCTTCAAAAAATGCGATTTGGGG + Intergenic
1013072397 6:106740995-106741017 CCTCCAAACCATGCGGTCTTTGG + Intergenic
1014391179 6:120867049-120867071 CCTTCATACTATGAAATTTGAGG - Intergenic
1015566476 6:134577279-134577301 CCACTAAATCAGGAGATTTGGGG + Intergenic
1016585732 6:145682322-145682344 CCTACAACACATGAGAATTGTGG + Intronic
1019148817 6:169990878-169990900 CCTCCAAACCTTGAGGTCCGCGG - Intergenic
1019252063 7:20717-20739 ACTCCAAATAGTGAGATTTGGGG + Intergenic
1023464661 7:40440740-40440762 CCCCCAAACAATGAGATCTTAGG - Intronic
1023755104 7:43408762-43408784 CCTCCAAACCATGTGACTGAGGG + Intronic
1029533074 7:101138190-101138212 CCTCCCCACCAAGAGATTGGGGG - Exonic
1031103566 7:117512078-117512100 CCTCTAAACAATGATAGTTGTGG + Intronic
1031775469 7:125903415-125903437 CCTCTAAACCCTGAGGTTTATGG + Intergenic
1033009774 7:137608625-137608647 CCTCCTAACTATAAGAATTGAGG + Intronic
1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG + Intronic
1034246238 7:149646666-149646688 CCTCAAAATCATGAGATTACAGG - Intergenic
1037759041 8:21729815-21729837 CTTCCAGACCATGAGAATTAAGG + Intronic
1039625994 8:39053892-39053914 GCTCCAACACATGAGTTTTGGGG - Intronic
1039814782 8:41083678-41083700 CCCCCAAACCATGACATTATGGG - Intergenic
1040697873 8:50023937-50023959 CCTCATAACCATGGGATTTCAGG + Intronic
1041313023 8:56535821-56535843 CATCCAGACAATGAGATTGGAGG + Intergenic
1043545347 8:81308984-81309006 CCTCAAAATCATGAAATATGTGG + Intergenic
1047628485 8:126680762-126680784 CCTCCAAACCATGGGATTAGGGG - Intergenic
1048426683 8:134329801-134329823 CCTCCAAGCCACTAAATTTGTGG + Intergenic
1050676390 9:8059577-8059599 CATCCAAACTATGGGGTTTGGGG + Intergenic
1052567729 9:30179439-30179461 TCTCAAAACCATGAAACTTGGGG - Intergenic
1055135172 9:72821170-72821192 CCCCCAAACAATGACATTTTTGG + Intronic
1055862766 9:80773104-80773126 CTTCCAAACAAGTAGATTTGAGG + Intergenic
1058098823 9:100894803-100894825 TATCCAAACCAAGAGCTTTGTGG - Intergenic
1059155744 9:111986943-111986965 CCACCACACCATGTGCTTTGAGG + Intergenic
1059948155 9:119434249-119434271 CCAGTAAGCCATGAGATTTGGGG + Intergenic
1062748278 9:138231198-138231220 ACTCCAAATAGTGAGATTTGGGG - Intergenic
1188659457 X:32740653-32740675 CCTCCAAAAGATGAGATTCGAGG - Intronic
1188706225 X:33335118-33335140 CCTACAAACTATAACATTTGAGG - Intronic
1189666192 X:43357420-43357442 GCTCCAAACTATGAGAACTGTGG - Intergenic
1190384271 X:49869265-49869287 CCTCCCCACCCTAAGATTTGTGG + Intergenic
1190424220 X:50317046-50317068 CCTCCAATGCATGAGAGTTCTGG + Intronic
1192499486 X:71640285-71640307 CATCAAAACCATGAGAGTAGAGG - Intergenic
1194628950 X:96259403-96259425 CCTCCAAAGCCAGGGATTTGGGG - Intergenic
1196493661 X:116297867-116297889 CCTCCAGCCCATAAGATTTAGGG + Intergenic
1196989301 X:121310476-121310498 ACTCCAAACCATGCAATGTGTGG - Intergenic
1197570505 X:128145399-128145421 CCTCAAAGCCATTAGATTTTAGG + Intergenic
1198343704 X:135739656-135739678 ACTACAAACCATAAGCTTTGTGG + Intergenic
1201148424 Y:11080127-11080149 CTTCCAACACATGAAATTTGAGG + Intergenic