ID: 943470796

View in Genome Browser
Species Human (GRCh38)
Location 2:188292018-188292040
Sequence TCTCTACGCCAACACGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943470796_943470806 26 Left 943470796 2:188292018-188292040 CCAGCGCCGTGTTGGCGTAGAGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 943470806 2:188292067-188292089 GCGCCCCGGCCGTGCCGGAGTGG 0: 1
1: 0
2: 1
3: 10
4: 111
943470796_943470803 12 Left 943470796 2:188292018-188292040 CCAGCGCCGTGTTGGCGTAGAGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 943470803 2:188292053-188292075 CGGCCTCGGAGACGGCGCCCCGG 0: 1
1: 0
2: 2
3: 10
4: 119
943470796_943470798 -8 Left 943470796 2:188292018-188292040 CCAGCGCCGTGTTGGCGTAGAGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 943470798 2:188292033-188292055 CGTAGAGAAACTTTCCCTCTCGG 0: 1
1: 0
2: 1
3: 9
4: 94
943470796_943470800 4 Left 943470796 2:188292018-188292040 CCAGCGCCGTGTTGGCGTAGAGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 943470800 2:188292045-188292067 TTCCCTCTCGGCCTCGGAGACGG 0: 1
1: 0
2: 1
3: 12
4: 123
943470796_943470799 -2 Left 943470796 2:188292018-188292040 CCAGCGCCGTGTTGGCGTAGAGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 943470799 2:188292039-188292061 GAAACTTTCCCTCTCGGCCTCGG 0: 1
1: 1
2: 1
3: 10
4: 95
943470796_943470805 21 Left 943470796 2:188292018-188292040 CCAGCGCCGTGTTGGCGTAGAGA 0: 1
1: 0
2: 0
3: 0
4: 23
Right 943470805 2:188292062-188292084 AGACGGCGCCCCGGCCGTGCCGG 0: 1
1: 0
2: 2
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943470796 Original CRISPR TCTCTACGCCAACACGGCGC TGG (reversed) Intronic
901429415 1:9203836-9203858 TCTGTCCGCCAGCACAGCGCAGG - Intergenic
904472858 1:30746582-30746604 TCTCTCCCCCAACAATGCGCAGG + Intronic
1083203246 11:61132434-61132456 TTTCCACGCGAACCCGGCGCAGG + Exonic
1090807304 11:130210498-130210520 TCTCTAGGCCAGCAAGGGGCTGG + Intergenic
1149600724 17:57891465-57891487 TCTCTAGGCCAACACGTGGGAGG - Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1161554486 19:4932933-4932955 ACTCTACGCCAACGTGGTGCTGG + Exonic
1161815325 19:6496206-6496228 TCTCTAGGCCAATCCGGAGCCGG - Exonic
936569413 2:113602218-113602240 TCTCTGCGCCGGCGCGGCGCGGG + Intergenic
943470796 2:188292018-188292040 TCTCTACGCCAACACGGCGCTGG - Intronic
1168874493 20:1161447-1161469 CCTGTATGCCAACACGGTGCTGG + Intronic
960256538 3:115516800-115516822 TTTCTAGGCCAACAGGGCCCTGG + Intergenic
961793264 3:129391759-129391781 TCTCTATGCCAGCACGAAGCTGG - Intergenic
961807267 3:129498377-129498399 TCTCTATGCCAGCACGAAGCTGG - Intronic
992038922 5:72809142-72809164 TCTCTACTCCACCAGGGCCCTGG - Intergenic
1007468751 6:42074372-42074394 TCTCTACGCCAACAGCTCCCTGG - Intronic
1031880484 7:127192764-127192786 TCTCTTCGCCAACAAGGCTTTGG - Intronic
1033227512 7:139573199-139573221 CCTCTACACCTACACTGCGCCGG - Exonic
1035301877 7:157902512-157902534 TCTCCAGGCCACCACGGGGCTGG - Intronic
1052852353 9:33385815-33385837 TCTCTTCGCCATCACGGACCAGG - Exonic
1053680452 9:40482366-40482388 TCTCTTCGCCATCACGGACCAGG - Intergenic
1053930440 9:43110677-43110699 TCTCTTCGCCATCACGGACCGGG - Intergenic
1058451213 9:105098205-105098227 CCTCTACTCCAACAAGGGGCAGG + Intergenic
1189868911 X:45361362-45361384 TCTCTATGCCACCACTGCTCAGG + Intergenic