ID: 943478023

View in Genome Browser
Species Human (GRCh38)
Location 2:188383798-188383820
Sequence AACTGATAGAAGAATTCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943478022_943478023 0 Left 943478022 2:188383775-188383797 CCATCTGATATACATAGGAGAGA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 943478023 2:188383798-188383820 AACTGATAGAAGAATTCTGATGG 0: 1
1: 0
2: 3
3: 25
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943478023 Original CRISPR AACTGATAGAAGAATTCTGA TGG Exonic
901178763 1:7325242-7325264 AAATGATAGAAGATATCAGAAGG + Intronic
905462564 1:38131180-38131202 AAGTGCGAGAAGAGTTCTGAGGG + Intergenic
905466078 1:38154469-38154491 AACTGACATAAATATTCTGAAGG - Intergenic
906345765 1:45013396-45013418 GACTGATAGAAGGATTTTCAAGG - Intronic
906423850 1:45692561-45692583 CACTGTGAGAAGAATTATGATGG + Intronic
907783302 1:57587222-57587244 ATCTGATGGAAGAATTCTCATGG - Intronic
909003992 1:70254435-70254457 CACTGATAAAAGAATTGTCATGG - Intergenic
909684059 1:78325895-78325917 AACTGAAAGAAAACTTCTAATGG + Intronic
909950749 1:81717383-81717405 CACTGATAGATGAATTTTGATGG - Intronic
910041598 1:82858704-82858726 AAGACATAGAAGAATTCTGCAGG + Intergenic
913960124 1:143333027-143333049 AAAAGGTAGAAGCATTCTGAGGG + Intergenic
914054480 1:144158600-144158622 AAAAGGTAGAAGCATTCTGAGGG + Intergenic
914124666 1:144807761-144807783 AAAAGGTAGAAGCATTCTGAGGG - Intergenic
916798508 1:168190850-168190872 AACTTGTAGAGAAATTCTGAGGG - Intronic
919120439 1:193333943-193333965 ATCTTATAGCAGACTTCTGAGGG + Intergenic
919458711 1:197850575-197850597 AATTTATAGAAAACTTCTGATGG - Intergenic
919533670 1:198758815-198758837 TACAAATATAAGAATTCTGAGGG - Intergenic
920241371 1:204553601-204553623 AACTAAAACAAGAAATCTGATGG - Exonic
922227486 1:223658108-223658130 CACTGAGAGAAGAATGCTTAGGG - Intronic
922285720 1:224168935-224168957 AACTGATAGAGCAGTTCTGCAGG - Intergenic
923587422 1:235286567-235286589 ATCTAGTAAAAGAATTCTGATGG + Intronic
924160056 1:241221733-241221755 AACTGAAAAAAGAATTCTGTAGG + Intronic
1064464247 10:15563297-15563319 ATCTGATAGAACAGTTTTGATGG + Intronic
1064593200 10:16915860-16915882 CACAGCCAGAAGAATTCTGAAGG + Exonic
1065278512 10:24111332-24111354 ACATGATAAAAGAATTCTGATGG + Intronic
1065385164 10:25126852-25126874 AACTCACTGAAGAATTCAGAGGG - Intergenic
1067028532 10:42865079-42865101 AAAAGGTAGAAGCATTCTGAGGG + Intergenic
1067427670 10:46221882-46221904 AGCTGATAGAAGAAGTGTGGGGG + Intergenic
1068021030 10:51584456-51584478 AAATGATAGGAAAATTCTCAGGG + Intronic
1070426182 10:76289926-76289948 TTCTGAGAGAAGAATTTTGAGGG + Intronic
1070460881 10:76668720-76668742 CACTGACAGAACAATTCTGGAGG + Intergenic
1071424316 10:85533071-85533093 AACTGATAGCTGAATGCTCAGGG + Intergenic
1073048222 10:100652477-100652499 CACTGATAGAAGAATGCAGGAGG - Intergenic
1074013344 10:109507061-109507083 AACTGAAAGAACAATTAAGATGG - Intergenic
1075373286 10:121955982-121956004 AACTGAGAGAAGAGATCAGATGG + Intergenic
1076039667 10:127234309-127234331 AAGTAATAGGAGAATTCTGTAGG + Intronic
1078914976 11:15770574-15770596 AACTGATGGGAGCATTCTCAAGG - Intergenic
1081436089 11:43028869-43028891 GACTGATACAAGAAGTCTGTTGG + Intergenic
1081617336 11:44598740-44598762 TAATGATAGAATGATTCTGATGG + Intronic
1081711352 11:45218447-45218469 AATTCACAGAAGAATTCAGATGG - Intronic
1081896068 11:46587688-46587710 GACTGAAACAAGTATTCTGAAGG - Intronic
1082157363 11:48840984-48841006 AATAGATAGAAGCATTCTCAGGG + Intergenic
1084348351 11:68573691-68573713 AACTGAGGTAAGAATTCTGCTGG - Intronic
1086935638 11:92743072-92743094 ATTTGATGGCAGAATTCTGAGGG - Intronic
1088330641 11:108647641-108647663 AACACAGAGAAGAATTCTGCTGG + Intergenic
1090111245 11:123911447-123911469 AACTGATAGAAGAGTCCTTGGGG + Intergenic
1090560180 11:127924125-127924147 ATTTGATAAAAAAATTCTGAAGG - Intergenic
1091626121 12:2122211-2122233 GAGTGATGGAAGAATTCTAAAGG + Intronic
1092515721 12:9210324-9210346 AACTGATGGTAGAATTCAAATGG - Intergenic
1092546162 12:9453038-9453060 AACTGGTAGAAGAAAACAGAGGG + Intergenic
1094427944 12:30335164-30335186 AACAGATAGAAGCATACTGTAGG - Intergenic
1094506786 12:31069020-31069042 AACTGGTAGAAGAAAACAGAGGG - Intergenic
1094705830 12:32913586-32913608 AACAGATAGAAGAATCTTAAAGG - Intergenic
1095908677 12:47403793-47403815 GAGAGAGAGAAGAATTCTGAAGG - Intergenic
1097239016 12:57561430-57561452 AACTGATAGAACCTTTCTGGAGG - Intronic
1098329508 12:69338470-69338492 AACTGATACAATCATTCTGAAGG - Intergenic
1098756728 12:74373222-74373244 AACTGATAGAAAAAGTCGAAAGG + Intergenic
1098894175 12:76038648-76038670 AAGGGATAAAAGAATTCTGTGGG + Exonic
1099275729 12:80573592-80573614 AAATGATATAGAAATTCTGATGG - Intronic
1099493116 12:83310202-83310224 AAAAGACAGAAGAATGCTGAAGG + Intergenic
1099942658 12:89207411-89207433 TACTTATAGAATAATTCTCAGGG - Intergenic
1100079448 12:90830073-90830095 CAATGAGATAAGAATTCTGAGGG + Intergenic
1101255207 12:102970385-102970407 AACTGATTGAATCTTTCTGAAGG - Intergenic
1103759547 12:123238439-123238461 AACTGAGACAAGAATTCAGGAGG - Intronic
1105438162 13:20394830-20394852 AACAGGAAGAGGAATTCTGACGG - Intergenic
1106503116 13:30348127-30348149 AAAAGGGAGAAGAATTCTGATGG - Intergenic
1106527295 13:30552646-30552668 AAGTGATAGAAGAATTAAAATGG - Intronic
1106674101 13:31939112-31939134 AACTGATACAAAAATTCAAATGG - Intergenic
1108430487 13:50348309-50348331 AACTGTTAGAATAATTGGGAGGG + Intronic
1108532101 13:51337101-51337123 CACTGTTAAAAGAAGTCTGAGGG - Intronic
1109572444 13:64210631-64210653 AACAGATAGAAGAAATTTGTGGG - Intergenic
1109691547 13:65898591-65898613 AACTGCTAGAAGAAATCATAAGG - Intergenic
1112045217 13:95589767-95589789 CACTGATAAAATAAATCTGAGGG + Intronic
1112147388 13:96715620-96715642 AACTGCTAGAAGAAACCTAAGGG - Intronic
1114727538 14:24954776-24954798 CACTGACAGAAAAATTCTGAGGG + Intronic
1114891299 14:26926960-26926982 AACTGAGAAAAGATTTGTGATGG - Intergenic
1115184892 14:30675626-30675648 AAATAATAGCAGAATACTGAAGG - Intronic
1117262165 14:54046926-54046948 AACTGCTGGGAGATTTCTGAGGG - Intergenic
1117683318 14:58227614-58227636 AACTGGTGGAAGAAGTCTGCAGG + Intronic
1118540963 14:66824853-66824875 AAGTGATAGCAGAATTCTGATGG + Intronic
1120440847 14:84537188-84537210 AACTGATAGGTGGATTTTGATGG + Intergenic
1120914004 14:89694272-89694294 AAATGAAACAAGAATTTTGAAGG - Intergenic
1121566374 14:94913017-94913039 AACTGATAGTATAATTCAGTTGG - Intergenic
1121865286 14:97357060-97357082 TTCAGATAGCAGAATTCTGAAGG - Intergenic
1121865444 14:97358605-97358627 AACTGTGAAAAGACTTCTGAAGG - Intergenic
1124987833 15:34639779-34639801 AATTTATATATGAATTCTGAAGG + Intergenic
1126482227 15:49138017-49138039 TATTTATAGAAGAATTTTGAGGG - Intronic
1126627153 15:50696020-50696042 AACTAAAAGCAGAATCCTGAAGG + Intergenic
1126928458 15:53618950-53618972 AACTAAAAGAAAAATTTTGAAGG - Intronic
1130793786 15:87187049-87187071 AACTGTGAGAAAAATTCTGTTGG + Intergenic
1131914503 15:97250118-97250140 ATCTGATAAAAAAATTCTGTGGG - Intergenic
1133500576 16:6362636-6362658 GACTGATACTAGAATCCTGACGG + Intronic
1138767441 16:59621442-59621464 AACTGATAGAATAAATATGGAGG + Intergenic
1140554132 16:75901238-75901260 ACATGATAGAAGAATACAGAAGG - Intergenic
1140771565 16:78209855-78209877 AACTTATAAATGAATTATGAAGG - Intronic
1141390537 16:83659449-83659471 AAATGATAAAAGAAACCTGATGG - Intronic
1143882233 17:10038556-10038578 AACTGAAAGCAGAGTCCTGAAGG + Intronic
1143941395 17:10545882-10545904 ATGTGATAGCAGAATCCTGAGGG + Intronic
1144358031 17:14464261-14464283 AACTGATAGAATAATACAGAGGG - Intergenic
1145825053 17:27870665-27870687 AATTGAGAAAAGAAATCTGAGGG - Intronic
1149216948 17:54368442-54368464 ACCTGATAGAGGATTTCTGTAGG - Intergenic
1150909493 17:69373140-69373162 CAATGATAGAAGAATTCTCTAGG + Intergenic
1154959585 18:21294976-21294998 AACTAATAGAAGATGTCTAATGG - Intronic
1155333881 18:24745681-24745703 AAATGACAGAATAATACTGACGG - Intergenic
1156159267 18:34340718-34340740 AACTGAAAGAAGAAAACTGAAGG - Intergenic
1156215595 18:34994922-34994944 AAATGATAGTTGAATTCTCAGGG + Intronic
1156511253 18:37638642-37638664 AACTGCTAAAAGAACTATGAAGG + Intergenic
1157032370 18:43927612-43927634 ATATGATTGAAGACTTCTGAAGG + Intergenic
1157930593 18:51817946-51817968 AAGGAAGAGAAGAATTCTGAAGG - Intergenic
1158474901 18:57771209-57771231 AACTGATGGCAGAATTAAGATGG + Intronic
1158511962 18:58098384-58098406 AACTGATAGAAGAAAAGTAAAGG - Intronic
1158927779 18:62286890-62286912 AGCTGATAATAGTATTCTGAAGG + Intronic
1159801750 18:72908802-72908824 AGCTTATAGATGAACTCTGAAGG - Intergenic
1160106956 18:75987268-75987290 AACTGACAAAGGAATTCTGCTGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166814417 19:45533922-45533944 AACTGATACTAGAATTCACATGG - Intronic
1166958416 19:46482085-46482107 AACTGAAACAAGATTTCTGCAGG + Intronic
1202693959 1_KI270712v1_random:111278-111300 AAAAGGTAGAAGCATTCTGAGGG + Intergenic
926418036 2:12669973-12669995 ACATCATAGAAGAATTATGAAGG + Intergenic
926971347 2:18470576-18470598 ATCTGATAAAAGAAATCTGATGG - Intergenic
927233197 2:20845418-20845440 AATTGATATAAGCATTCTAAAGG + Intergenic
927525443 2:23735913-23735935 ATTAGATAGAAGAATTCAGAGGG - Intergenic
928458466 2:31447365-31447387 AATTCTTAAAAGAATTCTGATGG - Intergenic
928713383 2:34032604-34032626 AACATATAGAAGAATTGTGCAGG + Intergenic
929992870 2:46804220-46804242 TAAGGAAAGAAGAATTCTGAGGG + Intergenic
930206365 2:48590283-48590305 AACTGATTGATGATTTCTCAAGG + Intronic
930607511 2:53507938-53507960 AACTGATAGAAGCTATCAGAAGG - Intergenic
930751114 2:54934877-54934899 AACTGATACTTGAATTCTCAAGG + Intronic
932049946 2:68388436-68388458 TTCTGAAAGAAGAATTCAGAGGG + Exonic
932402106 2:71487981-71488003 AACAGATGGAAGAATCCTGTTGG + Intronic
932939753 2:76149675-76149697 AACAGAGAGAAGAATTTGGAAGG - Intergenic
933952603 2:87343297-87343319 AAAAGGTAGAAGCATTCTGAGGG - Intergenic
934236846 2:90239643-90239665 AAAAGGTAGAAGCATTCTGAGGG - Intergenic
935882432 2:107578384-107578406 ATCTCATAGAAGAATAGTGATGG - Intergenic
936369917 2:111895283-111895305 ATGGGATAGAAGATTTCTGAGGG + Intergenic
940052511 2:149479392-149479414 AATTCATAGAAGGAGTCTGAGGG - Intergenic
940186493 2:150990705-150990727 AACTCAAAGAAAAAATCTGAAGG + Intergenic
940521868 2:154761140-154761162 TACTGATAAATGAATTCTAAAGG - Intronic
941556243 2:166985960-166985982 AATTGAGAGAAGCATACTGATGG + Intronic
941642060 2:167999296-167999318 AATTGTGAGAAGCATTCTGAAGG - Intronic
942768962 2:179492371-179492393 AACTGATTCAAGTCTTCTGATGG + Intronic
943348821 2:186772996-186773018 AATTGCTAGAAGAATTCAGAAGG + Intergenic
943448004 2:188013597-188013619 CACTGAAAGAAGAATTTTCAAGG - Intergenic
943478023 2:188383798-188383820 AACTGATAGAAGAATTCTGATGG + Exonic
943614024 2:190070806-190070828 AACTCAGAGGAGAAATCTGATGG + Intronic
944623746 2:201547645-201547667 AAGTGATAGAAGAATACATATGG + Intronic
944674785 2:202026203-202026225 AAGGGATGGTAGAATTCTGAGGG + Intergenic
945077342 2:206053069-206053091 AGCTGACAAAATAATTCTGAAGG + Intronic
947682054 2:232043580-232043602 TACTGAAAGTAGAATTCAGAAGG + Intronic
948480149 2:238244418-238244440 AAATGATAAAATAATGCTGATGG + Exonic
1168983016 20:2024104-2024126 GACTGATAGAAAAATCCTGCTGG - Intergenic
1169222902 20:3836856-3836878 AACTGTTAGAAGAATTTAGGGGG + Intergenic
1169328386 20:4696333-4696355 AACTAAGAAAAGACTTCTGATGG - Intronic
1169773536 20:9227430-9227452 AACTGATAGAAGAAAACACAGGG - Intronic
1171044983 20:21801986-21802008 ATCTGTTAGAAGAATTCTGGTGG - Intergenic
1171399721 20:24865005-24865027 AACTGTGAGAAGAGATCTGATGG + Intergenic
1173388478 20:42609997-42610019 AACAGATGGCAGAATTCAGATGG + Intronic
1177203440 21:17983458-17983480 AACTGCTACAAGAATTCTTGAGG - Intronic
1177566762 21:22832941-22832963 ATCTGATATAAGAATAGTGACGG - Intergenic
1178259367 21:31084596-31084618 AAATGATAGAAGACTTTGGAGGG - Intergenic
1178512229 21:33215191-33215213 AACTCACAGAAGAATGCTGTAGG - Intergenic
1181918758 22:26302628-26302650 AAAAGAAAGAAAAATTCTGAAGG - Intronic
1181979718 22:26757483-26757505 AACAGATAGAAGATTTCTTTGGG - Intergenic
949143246 3:662348-662370 AACTGATAAAAGAATTCAAGTGG - Intergenic
949619090 3:5789858-5789880 AAAGGATAGAAAATTTCTGAGGG - Intergenic
949879527 3:8650539-8650561 AACTGATAGAAGAAAAAAGAAGG + Intronic
952414103 3:33074913-33074935 AACTCAGAGAAGAATTCATAGGG + Intronic
952958926 3:38577626-38577648 CACTGATACAAGAATACAGAAGG + Intronic
952961168 3:38589952-38589974 AAATGATAAAAGAATTTTCAGGG + Intronic
953297245 3:41732025-41732047 AACTGCTAGAAGAATACATAGGG + Intronic
954769648 3:52954918-52954940 AATCCATAGAAGAATTCTGTAGG + Intronic
955696821 3:61645359-61645381 AACTGATAGATGATTCCTGGTGG + Intronic
956023030 3:64952231-64952253 AACTGATAGATGAACTGTGGAGG + Intergenic
956286753 3:67618487-67618509 ATCTCACAGAAGAAGTCTGAAGG + Intronic
957441669 3:80255768-80255790 AACAGAGAGAAGATGTCTGAAGG + Intergenic
960460821 3:117932915-117932937 AAATCAGAGAAGAATTGTGAAGG + Intergenic
960776461 3:121262052-121262074 TTCTCATAAAAGAATTCTGAGGG - Intronic
962521747 3:136203537-136203559 AATTGATAGAATATTTCTGAAGG + Intergenic
963326694 3:143871006-143871028 AACTGAAAGAAAAATTGTGAAGG - Intergenic
964945504 3:162218857-162218879 AATTGACAGAAGAGTTCTAAGGG + Intergenic
965028440 3:163332000-163332022 AAATGATAGGAGTATTGTGATGG - Intergenic
965056999 3:163732827-163732849 AACAAATTTAAGAATTCTGAGGG - Intergenic
965077590 3:163999058-163999080 AGCTGAGATAAGATTTCTGAAGG - Intergenic
965552767 3:169986064-169986086 AACTGATAGAAAAATGGTCAAGG + Intronic
965745521 3:171920860-171920882 ACCTAAAAAAAGAATTCTGAAGG + Intronic
966129662 3:176622965-176622987 AACTTACAGAAGAATTTGGATGG + Intergenic
967590398 3:191266851-191266873 AACTCTTACAAGAATGCTGAGGG + Intergenic
969359387 4:6652622-6652644 AACTTATACATGAATGCTGATGG + Intergenic
970268212 4:14313086-14313108 AACCACTAGAAGAATTCTGGTGG + Intergenic
974986269 4:69029903-69029925 AACTGATAAGAGAAGTTTGAGGG - Intronic
975319027 4:72988927-72988949 AAACCATAGAAGAATTCTAAGGG - Intergenic
976015605 4:80549314-80549336 AAATGATAGAAGAAATCGAATGG + Intronic
977724243 4:100276500-100276522 AAGTGTGAGAAGGATTCTGAGGG + Intergenic
977836511 4:101651756-101651778 AGATGACATAAGAATTCTGAAGG + Intronic
978721957 4:111920850-111920872 AACTGATAGAAAAACTATGAGGG + Intergenic
978823125 4:112988890-112988912 AAATGGTAAAAAAATTCTGATGG + Intronic
978951868 4:114570333-114570355 TACTGATACAAGACTTATGATGG - Intergenic
979543629 4:121915132-121915154 AACTAATAGAAGAATTAGAATGG + Intronic
980097446 4:128506093-128506115 AACTGGTAGAAGCTTTCTGGAGG - Intergenic
980771821 4:137383198-137383220 AACTGCTAGAAGAAAACGGAAGG - Intergenic
984741329 4:183166582-183166604 AACTGAAACAAGACTTCTCATGG - Intronic
986401631 5:7387390-7387412 AAATGAAAGAAGACATCTGATGG + Intergenic
986577123 5:9223923-9223945 AACTGAAAGAAGCCTTCTAAGGG + Intronic
987000976 5:13659309-13659331 TACTGGCAGAAGAACTCTGAAGG - Intergenic
987176542 5:15316819-15316841 AACAAAAAGAACAATTCTGAAGG + Intergenic
988844675 5:35115931-35115953 TATTCATAGAAGAATTCAGAGGG - Intronic
989069100 5:37491375-37491397 AACTGATAAAAGAAAGCTTATGG - Intronic
989333850 5:40291288-40291310 GGCTGAGCGAAGAATTCTGATGG - Intergenic
989817776 5:45757135-45757157 AACTTCTAAAGGAATTCTGAAGG + Intergenic
990573260 5:57100350-57100372 AACTGATAAAAGAATTCAGCAGG + Intergenic
991202556 5:64010970-64010992 AACTGAGAGAAGAAGGCAGAAGG - Intergenic
991430077 5:66535263-66535285 AGCTGATAGGAATATTCTGATGG + Intergenic
992807166 5:80349147-80349169 AACTCCTAAAAGAATTCTGGAGG + Intergenic
994678191 5:102851150-102851172 AAATTATAGAAAAATTCTAAGGG - Intronic
996261631 5:121477899-121477921 AACTGAGAGAGGAATTTTGAGGG + Intergenic
996407744 5:123123108-123123130 AACTGATATAACCTTTCTGAGGG - Intronic
996706551 5:126504008-126504030 TACTGATAGAAGAAAATTGACGG + Intergenic
997046554 5:130325918-130325940 GGATGAAAGAAGAATTCTGATGG + Intergenic
998289957 5:140905472-140905494 AACAAAAAGAAGAAATCTGAAGG - Intronic
998646518 5:144067919-144067941 AACTTATAGAAGTTCTCTGAGGG + Intergenic
998698557 5:144669686-144669708 AATTCATAGAAAAATTATGATGG - Intergenic
1000533650 5:162454246-162454268 AACTGCTAGAAGAAAACTTAGGG + Intergenic
1000942472 5:167378885-167378907 AACTGAAACTAGAATTCTGCTGG - Intronic
1001541386 5:172542334-172542356 AACTCAGAGAAGTAATCTGACGG - Intergenic
1002804292 6:557648-557670 AACTGAGAGAACAATCATGATGG + Intronic
1004801323 6:19151945-19151967 AACTGTTTGAAGTATTATGAGGG + Intergenic
1005081258 6:21958878-21958900 AACTGCTAGAAGAAATGTCAAGG + Intergenic
1005921120 6:30402716-30402738 AACTAATTGAACTATTCTGAGGG - Intergenic
1007167959 6:39841570-39841592 AACTGAGAAAAGGCTTCTGAAGG + Intronic
1011132775 6:84068967-84068989 AACTGATAAAAGAATTCAGCAGG - Intronic
1012577692 6:100823111-100823133 AGCTGATCTCAGAATTCTGATGG - Intronic
1012897883 6:104972455-104972477 AAGTTAAAGAAAAATTCTGAAGG - Intronic
1013056494 6:106588432-106588454 AAATGATAGAAAATTTCAGAAGG - Intronic
1014105850 6:117559580-117559602 AACTGACAGATGCATTCTCATGG + Intronic
1014399477 6:120969758-120969780 AACTGCTAGAAGAAATCATAGGG + Intergenic
1015681569 6:135814338-135814360 AACTGATTGAATAATTATGGAGG + Intergenic
1016763025 6:147761011-147761033 AACTGCTAAAAGAATTTTAAAGG - Intergenic
1016789287 6:148051176-148051198 AACTAATAAAAGACTTCTTAGGG + Intergenic
1020736954 7:11962643-11962665 AAGTGATAGATGAAAACTGAAGG - Intergenic
1021122150 7:16808030-16808052 ATCTGATTGAAGAATTAAGATGG + Intronic
1022255945 7:28657869-28657891 AATTCATAGAAATATTCTGAAGG + Intronic
1024980632 7:55154841-55154863 AATTGAAAGAACAATTATGAGGG + Intronic
1031447352 7:121871678-121871700 AACTTTTACAAGAATTATGATGG - Intergenic
1032059065 7:128708498-128708520 GACTGATAGGGGATTTCTGAAGG + Intergenic
1033996055 7:147349699-147349721 AGCTGATATAATAATTCTGATGG + Intronic
1035018136 7:155784059-155784081 AAGTGATAAAAGAGTTCTGTAGG + Intergenic
1038489941 8:27963591-27963613 AACTGATAGAATAATTTGGGTGG + Intronic
1039599687 8:38825054-38825076 AACTCATAGAAGCAAGCTGAGGG + Intronic
1040549720 8:48428797-48428819 AGCTGATGGAAATATTCTGAAGG - Intergenic
1041185380 8:55294734-55294756 AACTGATAGAAGTATGCTAAAGG - Intronic
1042127363 8:65551898-65551920 AACTGTTAGAACCATTCTGGTGG - Intergenic
1042243771 8:66690623-66690645 AACTGATACAAACATTCTGATGG + Intronic
1042666353 8:71210746-71210768 AACTGATAGAGGCTTTCTGAAGG + Intronic
1043350460 8:79354262-79354284 CACTGATAGAACACTTCTGAAGG + Intergenic
1044809937 8:96049531-96049553 AACTACTAGAAGAAATCTTAGGG + Intergenic
1045126788 8:99100618-99100640 AACTGATAGAACACTACTGATGG - Intronic
1046150385 8:110216688-110216710 AACTGATAGAAGAAAACATAGGG + Intergenic
1046155209 8:110280044-110280066 AACTGCTAGAAGAATACATAGGG - Intergenic
1047981332 8:130186182-130186204 AACTGATAAATGAATGCTGTGGG - Intronic
1048038218 8:130698358-130698380 AACTGGTTGAAGAACTATGATGG - Intergenic
1051126275 9:13809362-13809384 CAGTGAGAGAAGAATTTTGATGG + Intergenic
1051733241 9:20169844-20169866 ACCTGAAAAAAGAATTCAGAAGG + Intergenic
1052477224 9:28975041-28975063 AACTGAAAGGACAATTGTGAAGG + Intergenic
1052579548 9:30337579-30337601 AACTGAAATCAGAATACTGAAGG - Intergenic
1052737630 9:32359392-32359414 AACTGATAAAAGTTTTCTGGAGG + Intergenic
1053668052 9:40330600-40330622 AACTAATAGAAGTATACTGCTGG - Intergenic
1054379197 9:64470634-64470656 AACTAATAGAAGTATACTGCTGG - Intergenic
1054516559 9:66045689-66045711 AACTAATAGAAGTATACTGCTGG + Intergenic
1054832713 9:69644436-69644458 AACTAACAGAAGAATTTTGGGGG - Intronic
1056903272 9:90621327-90621349 AACTGATAGAGCAAATCTTAAGG + Intronic
1057403709 9:94747758-94747780 AGCTGAAAGAAGAGTGCTGAAGG + Intronic
1059114722 9:111590957-111590979 AATTGATAGCAGTTTTCTGAAGG + Intronic
1060487188 9:124055249-124055271 AATAAATAAAAGAATTCTGAAGG - Intergenic
1186374424 X:8983120-8983142 AAGTGATAGAACAAAACTGAAGG + Intergenic
1187783128 X:22851952-22851974 AACTGATAAAACATTTTTGAGGG - Intergenic
1189632408 X:42969019-42969041 AACTCATATATGAGTTCTGATGG - Intergenic
1190877279 X:54468936-54468958 AACTGTTTTAAGAATTCTGGGGG - Intronic
1192128850 X:68529457-68529479 AACTGACAGTAGACTTCAGAAGG - Intronic
1192687983 X:73327162-73327184 AACTGATAAATGAATTCAGCAGG - Intergenic
1192789014 X:74362475-74362497 AACTGCTAGAAGAAATCCTAGGG + Intergenic
1192828748 X:74728280-74728302 AACTGAAATAAGAACTCTGAAGG - Intergenic
1193432070 X:81420219-81420241 AACTGAGAAAAGTGTTCTGAAGG - Intergenic
1193604936 X:83554792-83554814 AACAGATATAAGAAATCTGAAGG + Intergenic
1193859477 X:86646485-86646507 AACTGATAGAAGAAAACATAGGG + Intronic
1194087446 X:89546378-89546400 AAATGAAAGAAGAATTCTGAAGG + Intergenic
1194186926 X:90782090-90782112 AACTGGTAGATTAATTGTGATGG - Intergenic
1194361637 X:92958937-92958959 AACTGAAAGAAGAATTGTCTTGG + Intergenic
1194796994 X:98224044-98224066 AGCAGATGGAAGAATTTTGAAGG - Intergenic
1195821376 X:108948564-108948586 AACTGTTAGAAGAAATCATAGGG - Intergenic
1198789541 X:140328601-140328623 CAGTAATAGACGAATTCTGAAGG - Intergenic
1200440093 Y:3202250-3202272 AAATGAAAGAAGAATTCTGAAGG + Intergenic
1200533516 Y:4364164-4364186 AACTGGTAGATTAATTGTGATGG - Intergenic
1200669828 Y:6074811-6074833 AACTGAAAGAAGAATTGTCTTGG + Intergenic