ID: 943479021

View in Genome Browser
Species Human (GRCh38)
Location 2:188395384-188395406
Sequence GTTCCAGAAAGGCTGTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943479011_943479021 20 Left 943479011 2:188395341-188395363 CCTGGCGTGCACTCCACCTGTGG No data
Right 943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG No data
943479015_943479021 7 Left 943479015 2:188395354-188395376 CCACCTGTGGGGATATAATCCCC No data
Right 943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG No data
943479016_943479021 4 Left 943479016 2:188395357-188395379 CCTGTGGGGATATAATCCCCTTG No data
Right 943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943479021 Original CRISPR GTTCCAGAAAGGCTGTCCTT TGG Intronic
No off target data available for this crispr