ID: 943479427

View in Genome Browser
Species Human (GRCh38)
Location 2:188399433-188399455
Sequence GACCTACTCTCTCCTAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943479427_943479433 15 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479433 2:188399471-188399493 AAGTTCTGGAACCAAGACGGAGG No data
943479427_943479438 27 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479438 2:188399483-188399505 CAAGACGGAGGGCGAATATGGGG No data
943479427_943479431 1 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479431 2:188399457-188399479 CAAAGGCAACTTTAAAGTTCTGG No data
943479427_943479437 26 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479437 2:188399482-188399504 CCAAGACGGAGGGCGAATATGGG No data
943479427_943479434 16 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479434 2:188399472-188399494 AGTTCTGGAACCAAGACGGAGGG No data
943479427_943479435 25 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479435 2:188399481-188399503 ACCAAGACGGAGGGCGAATATGG No data
943479427_943479439 28 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479439 2:188399484-188399506 AAGACGGAGGGCGAATATGGGGG No data
943479427_943479432 12 Left 943479427 2:188399433-188399455 CCTGTACTAGGAGAGAGTAGGTC No data
Right 943479432 2:188399468-188399490 TTAAAGTTCTGGAACCAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943479427 Original CRISPR GACCTACTCTCTCCTAGTAC AGG (reversed) Intronic
No off target data available for this crispr