ID: 943480273

View in Genome Browser
Species Human (GRCh38)
Location 2:188408824-188408846
Sequence CAGTTTTACACCACTGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943480273_943480279 18 Left 943480273 2:188408824-188408846 CCATTCACAGTGGTGTAAAACTG No data
Right 943480279 2:188408865-188408887 AATTTTGGGAAATAAATATGTGG No data
943480273_943480275 -8 Left 943480273 2:188408824-188408846 CCATTCACAGTGGTGTAAAACTG No data
Right 943480275 2:188408839-188408861 TAAAACTGGAAATCAATCACAGG No data
943480273_943480278 4 Left 943480273 2:188408824-188408846 CCATTCACAGTGGTGTAAAACTG No data
Right 943480278 2:188408851-188408873 TCAATCACAGGAGGAATTTTGGG No data
943480273_943480277 3 Left 943480273 2:188408824-188408846 CCATTCACAGTGGTGTAAAACTG No data
Right 943480277 2:188408850-188408872 ATCAATCACAGGAGGAATTTTGG 0: 2
1: 14
2: 229
3: 562
4: 964
943480273_943480276 -5 Left 943480273 2:188408824-188408846 CCATTCACAGTGGTGTAAAACTG No data
Right 943480276 2:188408842-188408864 AACTGGAAATCAATCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943480273 Original CRISPR CAGTTTTACACCACTGTGAA TGG (reversed) Intronic
No off target data available for this crispr