ID: 943483072

View in Genome Browser
Species Human (GRCh38)
Location 2:188446252-188446274
Sequence AAGAGTAATCATGTGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943483068_943483072 11 Left 943483068 2:188446218-188446240 CCAACTTGTGACTGTGAAACAAC No data
Right 943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG No data
943483067_943483072 26 Left 943483067 2:188446203-188446225 CCTAAATAGAGACAGCCAACTTG No data
Right 943483072 2:188446252-188446274 AAGAGTAATCATGTGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943483072 Original CRISPR AAGAGTAATCATGTGGAGGA TGG Intronic
No off target data available for this crispr