ID: 943483699

View in Genome Browser
Species Human (GRCh38)
Location 2:188454317-188454339
Sequence TTATAGGCACAGAATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943483693_943483699 1 Left 943483693 2:188454293-188454315 CCAGTATGGCTTAGTCTGGGGTT No data
Right 943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG No data
943483690_943483699 3 Left 943483690 2:188454291-188454313 CCCCAGTATGGCTTAGTCTGGGG No data
Right 943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG No data
943483692_943483699 2 Left 943483692 2:188454292-188454314 CCCAGTATGGCTTAGTCTGGGGT No data
Right 943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG No data
943483688_943483699 4 Left 943483688 2:188454290-188454312 CCCCCAGTATGGCTTAGTCTGGG No data
Right 943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG No data
943483683_943483699 30 Left 943483683 2:188454264-188454286 CCCAATCCTGCAGTCTGGTGGTT No data
Right 943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG No data
943483684_943483699 29 Left 943483684 2:188454265-188454287 CCAATCCTGCAGTCTGGTGGTTT No data
Right 943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG No data
943483685_943483699 24 Left 943483685 2:188454270-188454292 CCTGCAGTCTGGTGGTTTCTCCC No data
Right 943483699 2:188454317-188454339 TTATAGGCACAGAATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943483699 Original CRISPR TTATAGGCACAGAATGGGGA GGG Intronic
No off target data available for this crispr