ID: 943487365

View in Genome Browser
Species Human (GRCh38)
Location 2:188502917-188502939
Sequence TGAACTCTGTGTGCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943487363_943487365 -9 Left 943487363 2:188502903-188502925 CCAAGATGGCATCTTGAACTCTG No data
Right 943487365 2:188502917-188502939 TGAACTCTGTGTGCTCCAGGAGG No data
943487362_943487365 4 Left 943487362 2:188502890-188502912 CCTGTCTTTGCTTCCAAGATGGC No data
Right 943487365 2:188502917-188502939 TGAACTCTGTGTGCTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943487365 Original CRISPR TGAACTCTGTGTGCTCCAGG AGG Intronic
No off target data available for this crispr