ID: 943498313

View in Genome Browser
Species Human (GRCh38)
Location 2:188652609-188652631
Sequence GGTGGTGGCTGTTCAGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943498308_943498313 17 Left 943498308 2:188652569-188652591 CCAACTCAGTGGCATACAACAAT No data
Right 943498313 2:188652609-188652631 GGTGGTGGCTGTTCAGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943498313 Original CRISPR GGTGGTGGCTGTTCAGCTTA TGG Intergenic
No off target data available for this crispr