ID: 943498594

View in Genome Browser
Species Human (GRCh38)
Location 2:188656455-188656477
Sequence TTGTTCACTTTGAAGATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943498594_943498597 12 Left 943498594 2:188656455-188656477 CCTTAGATCTTCAAAGTGAACAA No data
Right 943498597 2:188656490-188656512 CAAGCTCAGGGACAGTATGAAGG No data
943498594_943498598 28 Left 943498594 2:188656455-188656477 CCTTAGATCTTCAAAGTGAACAA No data
Right 943498598 2:188656506-188656528 ATGAAGGTACTCTCTGTTCCTGG No data
943498594_943498596 0 Left 943498594 2:188656455-188656477 CCTTAGATCTTCAAAGTGAACAA No data
Right 943498596 2:188656478-188656500 CACGAACACTGACAAGCTCAGGG No data
943498594_943498595 -1 Left 943498594 2:188656455-188656477 CCTTAGATCTTCAAAGTGAACAA No data
Right 943498595 2:188656477-188656499 ACACGAACACTGACAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943498594 Original CRISPR TTGTTCACTTTGAAGATCTA AGG (reversed) Intergenic
No off target data available for this crispr