ID: 943499787

View in Genome Browser
Species Human (GRCh38)
Location 2:188672846-188672868
Sequence TATGTATCTCTATAAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943499787_943499789 -5 Left 943499787 2:188672846-188672868 CCAGTTATTTATAGAGATACATA No data
Right 943499789 2:188672864-188672886 ACATATTGGATTTGTTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943499787 Original CRISPR TATGTATCTCTATAAATAAC TGG (reversed) Intergenic
No off target data available for this crispr