ID: 943499837 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:188673892-188673914 |
| Sequence | AACTGCTACTAGAAGTTAGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 943499837_943499841 | 25 | Left | 943499837 | 2:188673892-188673914 | CCTTCTAACTTCTAGTAGCAGTT | No data | ||
| Right | 943499841 | 2:188673940-188673962 | AGGCTAGTGCTGCCTGCTTAAGG | No data | ||||
| 943499837_943499840 | 5 | Left | 943499837 | 2:188673892-188673914 | CCTTCTAACTTCTAGTAGCAGTT | No data | ||
| Right | 943499840 | 2:188673920-188673942 | CCATCTAGTACATGGACATGAGG | No data | ||||
| 943499837_943499838 | -3 | Left | 943499837 | 2:188673892-188673914 | CCTTCTAACTTCTAGTAGCAGTT | No data | ||
| Right | 943499838 | 2:188673912-188673934 | GTTTTTCACCATCTAGTACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 943499837 | Original CRISPR | AACTGCTACTAGAAGTTAGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||