ID: 943499837

View in Genome Browser
Species Human (GRCh38)
Location 2:188673892-188673914
Sequence AACTGCTACTAGAAGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
943499837_943499841 25 Left 943499837 2:188673892-188673914 CCTTCTAACTTCTAGTAGCAGTT No data
Right 943499841 2:188673940-188673962 AGGCTAGTGCTGCCTGCTTAAGG No data
943499837_943499840 5 Left 943499837 2:188673892-188673914 CCTTCTAACTTCTAGTAGCAGTT No data
Right 943499840 2:188673920-188673942 CCATCTAGTACATGGACATGAGG No data
943499837_943499838 -3 Left 943499837 2:188673892-188673914 CCTTCTAACTTCTAGTAGCAGTT No data
Right 943499838 2:188673912-188673934 GTTTTTCACCATCTAGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
943499837 Original CRISPR AACTGCTACTAGAAGTTAGA AGG (reversed) Intergenic
No off target data available for this crispr